Description :
From Genome Similarity Track
Location :
Scaffold_25:176418- 178289
Transcript NameFunction/comments
Phyra_7152860S ribosomal protein L15-1
Phyra_71529enoyl-CoA hydratase

Sequence
1871 bases(100 bases per row)
AGCGGTAGCGGCGCAGCGACAGAGTGTTGCGACGCTTCCAGTTCTGGCGGAACGACGAGCCGATGATCTTGTTGGCACGGTGGCCACGCTTGCGGAGGCC
ACGGCCCTGGCGGCCGGCCGACGTGAGGCCACGCTGCTGGCGGCCCTTGTGCACGGCGTTGGCGATCCAGTTGATGCGCGGGTCGCGACGGATGACCTTG
TGCGAGTGGTCGACCATGATGATCTCGAAATACTTGTACGTAGCGTCCTGGTTCACCCAGTACGAGTTGAGCACGCGCAGGTTCGTGAACTTGTTGCCGG
CACGCTCCTCAGCCACCGAACGCAGGTTGCGCTCGAACTTGAGCTCGTTGATACCGTGGTGCTTGGGCTTTCCGTACACGATACCCTTCGAGTTCGGGCG
CTTGCGGCCACCGCGACGCACGGCGACGCGCACAATGACGAAGCCCTGCTTGGCCTTGTAACCAAGGCGGCGAGCCTTGTCCACGCGGGTGGGGCCCGTC
ACGCGGTGGATGACCGGCAGCTGGCGGTACTCCCAGGCGCGCACACGCAGCAGGAAGCGCAGCACATCCGACTGTTTGCGCTTCCACAGCTCCTCCAGGT
ACTTGTAGGCTCCCATTCTTCTGCGACTTTGCTAAAAGGAAATGCTCCGACATATTGGGCCACCAGGCCAGGAACGTGCCAGCCCCAGCCAGTCATTCAC
ACCAACGGTCCCGCTAAGTACGACCGAGGTTAAAATGGGATGAGTCAATAAAACCTTGTTCGTATTTAAACAGGATGTTTCGTGTACCCCACACTACGAC
TGCTTGAAGTTGGCGCTCCGGATATTCGTTGTCGTCTTCATGGTGTTCACGACGATGCTGTTGCGCACTACCGCAGCTCTGCAGCAGACCGGCGGCCGCT
GGATGAGCGCGGCGGCTACGACGGCCACGCAATTCAAGCTGGAGATGCTGGGCGGCAAGGACGCGGGCATCGCGCTCTTCACCATGGACCGCCCCGAGAC
GCGCAACGCTCTCGGCCGCCAGTTCATGGCCGAGTTCCGCCAGGCGCTGGACCAGGTACGCTACGACCCCAAGGTCCGCGTGGTAATCGTGCGCAGTGTT
GTGCCCAAAGTCTTTTGCGCCGGTGCAGATCTGAAGGAGCGTCTAGGCATGTCGCCTCCGGAGGTACGACGACTCTATAGCTTGCGCATGCAGGGAGGTG
TTGACTGGGGCGTGATACTGCAGGCTGCCGCTTCCTCCCGTGGCTATCGCACGGGATTCACCGACTTGGAGCAACTTCCGATGCCGACGATCGCCGCTAT
TGAAGGAGCTGCACTTGGCGGTGGCATGGAGATGGCGCTGGCGTGCGATCTCCGCATCGCTGGCGCTAAAGCCATCCTTGGGTTTCCAGAGACGTCTCTG
GCCATTCTACCTGGAGCAGGAGGCACCCAACGCGCGTCTCGCCTCATTGGTATGGCCACCAACTTTTTGTCGTCCTTGCTCTTAATTGTTGTACATGTAC
TCATCGTATCATCCTCGCTCTTGCCCCGCAGGCATCTCGAAGGCCAAGGAGCTCATCTTTACGAGCCGCCGCCTCAACTCGGAGGCTGCTGAGAAGGTCG
GTTTGGCCGACTACGCCGTGCCTGAAGGTAAGGCCTACGACAAGGCGCTCGAGATCGCGCGTGAGATTCTCCCCAACGGACCTGTCGGCGTCCGCATGGC
CAAGGAGGCGATCATGAGGGGCTCTGAAGTGGACATTGCTACGGGTATGGCTATCGAGAACGCTTGCTACGCGCAGGTGATCCCGACCAAGGACCGCATC
GAAGGTCTCGTCGCTTTCAAGGAGAAACGTAAGCCGCAGTACAAGGGCGAGTAAGGCCGATCCGTCGCCTT