Description :
From Genome Similarity Track
Location :
contig_49:176416- 177419
Transcript NameFunction/comments
g8279.t1hypothetical protein PHYSODRAFT_557610

Sequence
1003 bases(100 bases per row)
TCTCTTGGATGGCTCGCAGCACCTCCTGTTTCTGGTCGAGTGTCAACTGCGCCACGAGGTTTCAGAATCAGCGCCACGGACGGTGTCGACGAACTGCAAT
AGAGGGAGCAACACACAAAGCACAACAACTGTTAGCAACACGATGTAGCGGGCCGTGTGAACACTAGAGGAACGACATACCGAATGAAGGTATTGAAGTA
GACCGTCGTGAAGCAGTTTGTGATCAGCTGACAGTCCATTCGGTCCATGACACCACCGTGGCCAGGAATGACCGAGTCGAAGTCCTTCAGGTTGTACGTA
CGCTTGATTGCCGAAGCGTAGAAACCTCCGAAGGGTGACACCACGGAGGCGAAGATCGCGAACCAGATGGAGTGAAACTGCATTCACGAACACAACCAGA
CAGCTCGTCAGCAATCGCCATACATCGATCTAGCCAGCCACAACATCAAACCTGAATCGGGAGAAGCTGGATCTGGCTTCGACCAATTAGACCCGCCAGG
TAGACCGGTACGCCGTAGGAATGAGGGAGGAACACGTCACGAGGTGTGCACGTGAGAGGGTCGGGAATCAGCTTGAACTGTAGCAAAATAAAGACATCAG
TGTTACCATAAGCACGTATGCTGCATGAAGACCAGTGCTTTGCAGCACTAAACACTGTGCTCTCACCTCGAAGCTCTCCACGGGGCAGGTCAACCAAGAA
AACTAAAACGAACAAAAGACAACACAATCAATAAACAAAATACGCGAAACGGTACCGTGTTTGCTTCGTACCTGCGAGATGAAGGCACTGGAAAAAAAGG
CATAAATCACGGTGCAAACGAAAGCACCTATGAAGCCCTCCCACGTCTTGTTCGGGGACAATCGCAAGAACGGCGTCTTAATGAACTTGCGACCAAAAAG
CTTGCCGCAGAAGAACGCAAAGCAGTCGTTGCAGATCACGAGCGACACGGGGAACAAGAACCAGAAGAGACCTAGAGGGGTGAACAAGCATATGAATCCC
GTT