Description :
From Genome Similarity Track
Location :
Scaffold_1202:1764- 5695
Sequence
3931 bases(100 bases per row)
CAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACAACGCAAAGGAAACTACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCAGATCCA
CGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATTCGGAACCATCCACGGACGCAGAGTGCAGATTTTCCACTGCTGCTCCACCCCATCC
CCACGTCTCGCCAAGACGCTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCTTTACCGACGGGTACACAAGGTGAGGAA
AGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAGGCTGGATCCGGCAATCTCGCAGATTTTGCTGACC
CCGCTACACCACAATGGTGCGCGTGCCCGGACCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAA
GAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGG
TGGATCCGGATCCGGATCTAGAAGAAAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAA
ACAAGGGAATGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACATAAGCCCGCTAGTCGAAGAAACGAGAAAG
AAGACGAAAGCGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGACCCAGGTCAAGCTGGTCCGACAAGGATCTCG
AGTTTGTATATCGCCACCAAGCTTTACGCGATTTTCTGCATCACGATCCTGTCATGCGGATCCTAAATCCACGACAGATCGAAGATCCAAGGGAACCGGT
GAGAGCACCAACGAAAACGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAG
GATATCTTCGAGCTAGACTTGGATCTCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGATTT
CGGTGTCGTCGCCGAGGGTCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACATGTCGTCCGAACCACGACGCATGACATT
AGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCAGTAGGCCCTACGCGT
GATCTGACACAATCCAGCCACGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCT
CGCCAGTGGACCAGACGGCCACAGGCGCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGG
TATGGGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAATCCGTGGAGGGAGACAACGCCCATGATGAGTTC
GACCCAGATGATCTAGATGGCCCATCCGCTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCT
CAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCA
AGCGTCGTATGCTGAGAAGTGTTTGACCTTTGCTGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCATCTGGGCAGATCCACTGGAAACAAGTGG
CCAGATTTGCTGCGCAGTTTCCAGACACAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCACGCTCGCCGCAGATCGGATGAATCCCCGC
TAGAATACCTACATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCAT
CGAGACGGTGGGAGACGTGGATCTGGCCGACAGGCTGACCCTGTTGCGACTTCCCGACGCAGACGAGCTTGAGGAAGTGCTGCGGGCGGTGGATCGCGCG
AAACACCGCCAGAGGAAGGCGGCGGTCGGATCCGGCAAGTATCGCCAAAAGGCTCCGACGCCTACGGCCCCAGCTCGACGTGTCCACCAAGTCACGGCGC
CCGACTCAGGAACTGAATCAGGATCCGACGGTTCGGACTCCGACCCTGAAGATTACCGTCGGGTCTGTCTCACTGCGTCCAACGATCGAACGGCGAAGAC
AGGAGACAACTCTCGACCGGGGGATACCGTACCCGGGGACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGGCAGCACAAGTCAGGTGTTCGCAG
TGCGGATCCCGGAAGCACACTGAATCTGGATGCTGGAAACATCTGGTCAGTGAGAAGTGTGGCAAGAAAGGTCATCCCGGGGATCATTGCTTCTACGTGT
GTCGCGGGTGTGGCGAGATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCCGCCAATGGTTTGATCCAGCCAAGCACCGAGGGAT
GTTGCCAGAAGTGGCCGAGAAGATGTTAAAGTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCCGAGCGTTCTAGGTACTGCATTTATGCATTTGTGA
ACAAGACATCGCTAGATTCAGGTAGCAGGACCCTAGATCCAGTCGATAATACACGTGATCTACATGAAGTGTCAGCTGCCAAGATCTCTAGTTTGCGCCA
AGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCCTGGATCTACAAAGGGGAGAGGCACGTGGTTATTGGGAGAAGCGCCAACATGGTCGATGGTTT
GAGCCTACCAAGGGTGAGGTCACTGCGGATCCACCTAAGGTCTGTCAGGTCACTGGATCCCGTGGATCTGAGGATGTTGGATCCATGGATCTGCTAACCG
GGGAGTCTTGTGGATACTGAAAGTACCATGCCCCAGGAAAGTGGTTCAGACAAGCCAAGGTAGGGGGCAAGATCAACAATGAAAAAGCAATCCTACTCCT
AGATAGTGGTGCCGAGGTGTCTATACTAGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGGATGGGAGTCGGATCCAAGACTGTGTTGGGATTGGT
GAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTGGTGTATTGGTTTAACATTTGGGTTGGAGATCTCGCTGGTC
AAGACGCCATCCTCGGGATGGATTTCATCGTACCGGCCGGAGTGAGGTTGGATCTAGCGGATGGGACACTTTGTTTCCCTGACGAGATGCGGATCCAGCT
CAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATGAGGGCGGATAGGACCACCTGGATCGAGCCCGGGGAAACTTGGGAGCTGCCAGACCGG
TCAAAGTGGGCGGAACATGAAAGACTGTGGGTCACCCGGGGCGAGAAATGGGTACCTACCGTAATCCAAGGACCAGGTCGATCGCAATACCTCCAGGTCA
CGAACGTCAGCGACAAGAGATTATTACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGCCGGTATCCCTAGACGACCTGGATATGTGTCAGT
GGGATCCCGCCGCTACAAAGAATGGCAGAAT