Description :
From Genome Similarity Track
Location :
Scaffold_9:176390- 181358
Sequence
4968 bases(100 bases per row)
TCATCCGAAGAAGAGACCTCGTGATGATGGTACGGGCGGAGACGACCGACATAAAACGTAGGATGCGTACGAATCCTGCAAGGCAACTCTATCGTGTATG
CATTGCCTTTGCGATGTAGTACACAAAACGGGACGATGTACTTCGGTAGTAGTTTACTACTACCCACATTAGTTACTACATGCTTAGGGTAGATTTACCG
TAGACAGCAGAACTAAGTCTCCGACATTAAATAGAAGAACGTTTGCTCGTCCATGTATGTCAGCGTTCCGTTTCTGCCGGTCCACCACGTTAGCCATGGA
GTCTTGCCCGAAACGGACCACTGCTTCTCGTGCCAGCAGGAAATCTTCTGCTGCATCACTTTGGTTTGTTGCAGTGCGCCTTGTGCGCACCGCTAGGAGG
TCATTCTCTTTTTTAGCGAGGGTGTTCTCATCCTCGCTGGTGTAGTCGTTGGTGATGCTAAATATACCAGTATCGTCATCCTCATCTGGGTCAGCAATAG
TGTCGTCACTATTGCTGAGATCATCAGCTTCGATGTCGACTTGATCGACAACGACAACGTTCGCGTCGTAGATTACCTCGACACGTAATGAACAAGAGCC
AGAACGGTTTTTATGCTCGAGCGAATCCCCCCCTTGAATTAGTGTCACACTCTAAATGGGTGGGTAGGCTTGAATGGCTTACGCCATCCACGAAGTATGG
TGTATGCGCGGTCGAAGCATGCACGGAGTTGTTGATTGCAAACTCCACCATCGGCAAACATTCGATCCAATCTGTGAAAGATTGGACGTTTCCTCAAAGT
ATCTCTTCGAGGAAGCGGTTGACGCGTTCTGTCTGACCATCAGTCTCGGGATGGTCAGAAGTAGACATAGTCAGACGTGTCCGAGGGATCAGAACACGGA
TTGCCAAAACGTCACCGTGAACCGATGATCTCTATCAGAGACTAGCTCACGGGGTAGACCGTGGAGTCGAAATACCGTGTGAATGAAGACACGGGCACAA
CTATGTGCTGAGATTGAATCATGAACTGCAGCAAGATGTACCATCTTGCTGAATCGGTCATGACTGAAGTGAATTCCATTGAAACGGACTGCCGGCACTC
AGTCGGGATTGGTAGAGGCTGTAGTGGGGCACACGAGGAAGGACTGGGCTTCACCCGTTGGCACACTTCACAAGCACGATTTTACTTGCGCACAAATTGA
TACTGGCAGGGCAAGTTAAATTTGCAACTTACCGTGAGATAAGTCTTCTCACGCCCACGATGCCCACTAGTTGGTGCATCGTGGCACTCATACATGATGC
GTAATAGCAAATCACTATGAGTGGGGACGACGACACGAGATGTGTCGCCGGTAATGGCTGTATAATACAGCAACCCGTTACGTGTTGTGTACCGATCCGC
GGAAGATCGATACAAGGTCGGTAAATCTTTGAGAGATTTACGAGATGGAGTCACCAGATGATCCATTAGTCGCAGATGAGCCTTATCTTGTGCGTAGGAC
TTTTTATGTCGTCAAGCAATGTTGACGACGGGATACTAGTGACTAGTGTTGAAACAGTGGTATCGACCCCACTGTTGGACTGCGCAGCCGACTCGAAATC
GGGTCGGCGCGACAACGCGTCCGCGACGACATTAAGTCGTCCGGGTTTGTACTCCACGGAGAAGTTGTACTCCGCAAAGAAGAAATCCACCTCACCATCC
TTTGCGAGAGGTGTAAGCTGTTTACGGCCGTGCGTAAGGACGCATGGTCCGTATAGACTACGAACGGCCTATCTCCAAGGATACAGACGCGAAACTTCGC
TAGTGCATACTTCATGGCAAAGCGTTCCTTGTTATGCACTGGACAATTACGCTCAGCTGCTTGCAGCTGACGCGATTAATAACAAAAGACGCAATCTGCG
TCGTCTGCATCGTACTGCATTAACGTGCAGCCGATTGCGAAATCGCCGGCGTCACAGACCACATGGAATAGTCTGTCTTGGTCTACAATCGCCAAGATGG
CGATTGTATCAAGCTCTGCTTGATACCTTCAAAGGAACGCTGACAATCAGCGTTCGATGACCATTTCGCGTTCTTTTCAAGAGACGAAAGAGATGAACAG
TCATTTCAGCGTAGTTGCGCGAGTACTTGTGTAAGTACGCCGTTAAACCAAGGAACTTTCTTAGTCTCTTAACGTCGACTGGCACAGGCCAGTCGGTAAT
CGCCTTGATATTTTCACGATCAGGGCGTACGCCGTGTTTACCCGCGATGCACCCAAGAAGTGGTATTTCGCTAGCAGTGAATATACACGTCTTGAGGTTG
GCATACAGCTTATGCTTGCGCATAAGTGTAACGACCTGACGAACATGTGTTCTATGAACCTCTGCGTCCATCTTTCCGCCCATAGCCCGGATATGGACGA
ATACATTGTCGAAGTAACTCGGTGCGAAGTCTCACACCGGTCTCAACAGATTTTTAGCACATCTGTTGAATGTGGCAGGGGCGTTACTAAGCCCTTGTGG
CATTACTAGCCACTCCCAAAGCATGCCGCTCGGGGTGCTTACTGCCGTGTACGGGATGTCCCGTTCACGTATTAGGATCTGAAAGAAGCCATCCATCAGA
TCCATGGAAGAAAAGATGGTACTTTTTGACATACCATCAATGCTTTGGCCCTTCCTCGGTATCGGCGTCCGAGCCGGTACCGTTGCATCATTCAACTTGT
TGATTGCGTGCACTATCTGCCACCATCCTGTAGCCTTGCGCACACAGAAGGTTGTAGAGCTGTGAGGGGAAGTTGACTCCCTCACATGACCCGCATCTGA
GCGATCGGCAAAGAACTCGTCGATCGCAAGTACTTGTTCACGAGGCAGTGGCCACTATTTCATGACACAGTACTTCGAGCCCGGTTTGAGTCGATTTAAT
GTCGAGTGCCTTTATCCTTAGGCAATTTGCATGGTACGGATTCAGGGAGCACGTCCTTGAACTCGATCAAATTCTTATATGAAGGATTTGCTTGAAACTA
CTCCCAATATTGAGACGTGTATCTCTCAATCCGACCCTTCTCATCGAAGACACTCTCGTCCATCGATGAGCGGCTGAGGACCCGTTCGTTCTCGGCAAAT
ATTACTGCCGACCGAATGTCAGTCACGTACTCGTCCTCCATGAAGATTACACAGATATGCTTGACCTTGCCACTACGCAGATCTCGCAAGAACCGTTTCG
GTTCTAGCGTTGTCAATTGGGTGGTATCCGAAGTCAACTTCGGAGGTGCGATCATATCAAGTGTATAAGCGCCTACATTTGACCCGTCATCAGCCAAGAC
TTTCAATGTTTCGGTTTATTCCTGGGAACCCTTTTCCACAGGCTGCTGGAGACTTATTCCCTCGACGTATCCTTGATGTGGTTGCGCTACCAGAGCTAGG
TCCTCTGCGATCGACTCTCCAGCCGATCTAGGATCATCGTGTTGCCCTGTGTGGGCAACTGGTTTATTCTTACTTGGATATCGCCCGCTAGGCGCTCCCA
TGTCCCGATCCACTCGACTTGTTCGAGTGGTGGACCTTCGGCGCTGCCTGTGCATCCGCACAGCCGCCGGCAGCTTCCTCTACAGTGTGATTGGTTGTCA
CACTGTGCTCTTGTGCAGTCGTACTAACGACCGTACCGCAAGTAAGACCATCGCACTCACTCGCAGTACATCCACACGCTTGTGGACTCTCCAAGACGTT
CATCAGATGGACACCAGATGAACAAGTGCCAGGCATCTTCACGGTTCGATGCTGCCAGCTGACCCTTGGCTCGTACCTTCTGAGCCAGGGTTACCTTAGG
ATGACATCATATTTGTCATCCAAACCAAGTACGATGAAATCATAATTGTACTGCAAACCTTCTTACGTGTAGTGAAATTTCACTTCAAGCTTCATCACTG
CTATCGATGCGCCTGTTGCAAAGCGCGCCGTCAGCCTCGTAGGAGGAGTAACGCGCCCAACGAACTTGAGCCTACGATCCTCTAGCGACTGTCGACGAAC
AAAGTTGTTCGACGCCCCCCAGTCAACTAAGGCACGAAGTGACAAACTTTTGTCACTTCTAAATTCAAGGTGAGGAGGGGTACCTCATCACCAAGTGCAG
AGACGCACAAGGATTGTGAGCCTGGAGCAACTTTCATCAATAGATTTGCAAATTCTATTGAGGTTGCTGGATCAGCAGAGCGCTCCGACCCTACTGACCC
CGACCGTTTTTTGACGGTCCGCTACGCTGTTGTGACTTTGCAGCAGCGTCAGACCCGCGTCCGTTGCCCTTCTTGGCAGACGGTCGATCACTTCGCTTAG
TGTTCGGATACACTGGGCGGAAAGCACTACACTTTTAGGCGTAGTGTCCTAACTTCTGACAGCGATTGCACTTTTGCAATTGCTGATTACTTGAAGAACG
AGGTCTCCCACGCTCGACACTGCAGAGGTCCATTGGTTATGGACCTCCCGCCTCTACTCGTCTCGTAGGACGATAGGGGGTCAAGATAGTATGAGCCTGT
CTCACACTAAATTCCCCTTACACCGTAGTTGTGATCGCTTCCTCAAGCGACTTCAACTCGATGCGGAATAGGTGGTTCCTCACGGAACCATCTATGAGCC
CTGTAAGAATATCGTGATCAACACGAATTCACTTACAGGGTTCGCTACCATGCAACTTGCAAGGTAACGGACGTGCTGAGCGTAAGCGTGAACGTCACGT
TTACCTTGTTTTATCTTCAGGAGCTCTGAAAGAGGCCTGAACTCAGCTCTTAGCAGCTCAAACGTTTGGTTAAGCAGAGTCTTAAAGACCGCCAATAATT
CAAACATGTTGGATCGTGTAATTGAAGATTCAGGGCCTGAGTTCTGGCATGCCCTGCCAAATTCGATTTGGCAAATGCAACTTGCATTTCCTCATCGTCA
ATGTGGTGAGTTTTAATGGCATCGTACACTTCGAGGAACCATCTGAACAGTGAGTCTTCCTCGACTCC