Description :
From Genome Similarity Track
Location :
contig_124:17638- 22925
Transcript NameFunction/comments
g13503.t1hypothetical protein
g13504.t1hypothetical protein

Sequence
5287 bases(100 bases per row)
GCACGGACCGCGGTGGAGGTTTCTGCGAGGTGCACCGTCGTGGTCGCCTCTGCAAGGTCGAGGGCTGCAAGAAGCTGTCCCGCAACCAGGGCATGTGCAC
CATGCACATCCGCGAGGAGAAGCAGGACTCAACCAACTTCGATGCTCCCATGAAGGCCGAGTCTGCTGTCGCTCTGGCTGTCTAAGGATGATCGTTGCCA
GATCTCCTATTCTCGATCCTGGAATCCCGTTCTTCCCTCTCTACAATCTCCGCGTCTTCGTCGTCCCTCATTCAAAGGAAGATGAGGAGGGGAAGAACCA
GAAGTCGATGTCCGACAACTCGAGCTGTCGTCTATCGCTCGAGTTTATCTGTCTCTATGTCTCCAGTTTGTATTCATCGGCGTTCGTGCCAACCAGTTTA
GTCTACGTGAAAGCCTCTGTCTCCGTGAAGTGTCCAGTATTTAACTCATAATGCGCGATGAATGTATGAACCTGTCGACCCAAGCATTTCTTGACTTTGC
CTCACGTTTCCTCCACACCTTGCAGCACCTCGACATTTTCTATCTGTTTACGTCGCGTCGATGACGGCCATTCAAGGCAACGAAAATGCGGTCGCCAGGA
GCAGCGGCGAGCATTGCAGATGTTGGTCGTTCTCGTGGAAAGCCCCGTTGGCCGCTTCAAGCAATGGTGCCAAGCTCTCCCACGCTGCCAAAGAAGCGCT
CGAACACTCTGTCCTACCCTGCTGTATGGCTTGGCGATGGTTGCATGCCCAACAGCCGACACCGATTGGAATAGAGCACAATGCCGATTGCACAACCTCA
TAATACTTGCATTGGTTTGTTTACGATAAGTGTCAGTCAGACAGTAAGTACATGCTCCGTGGGCTTCGACGACGCTTATGGCACGCCCCCGGACAAAACG
GCACTGGTCTTGGGCGACATTGAAGCTGTGGATGACACCTCGTCCATATCGTCGTCCTGCGGGATCTCCAGGTGAAGCACCCGAGCGTGGTGAATTTGAC
GAATCGGCTGCGGGTGGTCGATCTGCGGCGGCATGGCTGTCCGGTGCGGGTGCGCGGCCTTGCCATGGGTGACGTGGCTGTGGTGGCCCTGCGGCAGCTT
GGCACTATGGTGCATCTTGCCGTGCGGCGCCTTGGGCTCCTGCTTGGGCTCCACGGGCTTCACCGGGTTCTTCGCTGGCGAGAATTTCGAGTACAACCCG
ATCATCTCCTTCTTCATTTTGGCCTGGTACTTGCTGTGCTCACGGCAGTACTCGGTCGTGAAGTTTGCAATGTGCGAGAGCAGCACGTCCAGCTCCTCCT
CGGTGTCCTCTTCCTCGAAGTACTCGAGGAAGTGCGCCTTGGCCGCGTTCAACTTGTCTAACAGACCCTGCAGAACAGAGAGCTCCGTCTCCACTTCCTT
GCAAAACTGCTTCAACGTGTTCTTAGAAGTCGCCATCGCGTCCTTGTCGGCGTCGCTAGCAGTAGGACTCGGTACTGTAGCCTCAGCCTCGCGCAAAAGC
TTCTGCCATCCCGCCTCGAGTCCATTCTTTTCCGACGCAAGCGATGCGTACGCCACCTTGCTGCACTTGGAAATGAGGTCGATGTCATTGTAGAAGTGTG
CAAGGTGGGGCACGTCGCGCTCAATCGATTGCACCACATACTGCAAAAAGGTGATGCCACCCACGAAAGCCTTCGTCTGCGAAAACTTGACCAGGGAGCC
CAGCGAGAAGGCGTCGACGCCTTGATGTTCGTCATCGCCGCCAAAGTTGAGCAAGTTTCCAATCTGGAGAATATAAATAAATAGTTGGCGTAGTTCTGCG
CTTGAGCACACCTGGTACACGCCTCGGGTCACGAGGTCCAGCGACACGCGCAGCTCGTGCACGCGCGACGGGAACTCCTGCTTGAATACTAGACATCCCA
GTTTCTCCTGGAAGCGTGGCACACTGCGCACTTCCACCAGAAACTGTTCGGCAGTGCCGATTGTTGACACATCGCCGTTGAAGGCGTTAATGGCCTCCAT
CTCCTTTCGGTCGGGCCACATGTCCATGAGAGACCGCACTTGCGAAGTCGAAAGCACCGTCGAGTTCATCGCCAAAATCTCGCGCTTGAGCTCGGGGAAG
GGCATTTTTACGCGTGCCAGCGTGATGGCGATGTTCTGCGATTTCTTCATATCGATGAGCTGGACCATCGCCTTCTTCTTCTTGGCGGCAGCACCCTCAG
ATTTCACGGTGGCAGTGCGCTTCTTGCTCTCCGTAAGATCCTTCACGAACAACTTCTCGAGCATAGCACGGCTCTCCTCGGAAATCTGAACCTGCTCCTT
CGCCTCCTCCACGGTATCGCCACCCCACAGACTGTCGCGACGCGTCCGGTGTTTCTTCCCTTCCCAGTGCAGCTTCTTGCGGATCGAGTCTTTGCGTTTC
AGCGTTTTCCGCTGCGGTTCCTCAACAGGAGCGGCAGCACTCCGAGGACCGTTCAGCTCCGCCGGGTCGAGTCCCGCCAACCGCATCTTTTGCTCGACCG
CGCCGCGCGGCAAGCCCATTCGAAGCATCTGGAAGTACTTGTGGTATTTCTTGCGGTGGGCGACTCTTTCCTCTTCCGAGATCTCCGACGCAGCTGCGGG
CTTCGGCTCCGGCCTCTTCGGTGGCCCCTGCAGCCATGCCGGGTCCACACCGTCCATGCGCATCTTGTGCTCCACAACCGACGGAGGAAGACCCACCTTC
ACCATCTGCGAGTACTTGCCGTGTCTCGCCTCGTACTCCTTCAGCTGTGCCTGGTACGCTGCCTCGGCTTCTGCGTCGAGAGCGGGTGCAGGTGTCTCCG
GCAGGGGCTTGTTCGGGTCCATGTCCAGAATGGTCGGGTCCACGTTCTCACTCTGCATCTTGTGCTTCACAACAGGAGCGGGGAGCCCCACCTTCAGCAT
CGTGAAGTACTTTTGATACGTTGGGTGATCTTTCAGCGGGGTTTGGTCACCACCAGCTGCGGGTGAGGGCGTGGCAGCTCCTGCTGTTGCTGCAACAGGT
GCTGGCTGGATCGCTTGGCGCTGCTTCAACATCGCAGCCAATGGATGTGCGGCCCCGCTCGTTTCCTCCTGTGCAACCGCTGGTGCCGGTGGGGGCGATG
GCGCCGCTCTCCTCGCTAGCATGGCCTCCAATGGATTAATCTTGTTGGTCTGGGTGGGCTCATCGTCCGAGGCTGCGGGCGGCGGTGAAGATCGCTTCGC
AAGCATGGCTTCCAGTGCGTTGTTCTGGCTGGCTGGCACCTTCTCCGGGTCAACGCTATCCGTTGGCGGAGCAACTCGCTTTGCAAGCATCTCAGCCAGC
ATGTTACTTCTAGGTGCAATGGGCTCGGAGATCTCCCGAGAGTCCTCTTCGGGTCTTGATACTGGAGGTTCCTGTCCCTCCTCATCGGCCTCGTCCGGCT
GGGAGAGTACGCGATTGACGAGCATATCCGCTACACTAGCGTGTCTGTCGACACCCGCGGGCATATGCCGCTGCGAGAGCATTTCCAGCAGCCCCCCACC
AAAAAAGTCCTCGCTGTTATTTCTTGACCTTGCCGGGACGAGTACATGGAGTCGAGGTCGTCCATCTGATTGTCGCTGTCCTCGTCATCGAGTCTCACGT
CGGCCAGGAAGTCGAACGAATCGTATCTCCTACGCTCTTTCTTCTTCTTCTGGGGGGTTCTTTCCACGGGTTCTTCGTCGGGCTGTTCCTCCTCGGCCTG
TTGCCTCGCCAGCAGCTCCTCGAGCGCGCTCTGTAATCGGCCACGGCCTCTTACTGCACCTGTCAGTTCCTGCTGGTTGTCTTCAGAAGACGTGGAGGAG
GTCGCGGAGGACCCCCGACTCTCCGGTGCATTCCGGTCCACGAGCTCCCGCACATCGATCGCCTTGTCGTCGTTCTGTGCGGCTTTCTCGTCCTCGGCGG
CGCTGCCGCTATTGTTGCGGACGTCCCCGCCGTTGGGACTGGTGGACGTCGTGTGCCGGAAGAAGTCCTGCACCTTTTGCCGGTCGTTCCAATGTGTGGA
AGTAGCTGTGTGTGTGGAGGTGGCGGTTGCTGTACTGGTGGTTGCGGCCGTCTGCGGCTGGCCGAAGGGCGTGCGCTGGAAGCCGCTCATGGGCAGGCCG
AACTGCAGCCCCTCGGCGCGGGCCGACGGGCCCCGCACCAGGTGCGGCAGCGAGGGCTCCGCTGCCGAGGCCGGACTGCGCTTGTCGGCGCCCATGAGCA
TGGAGATAAAGGACGGTGCCATCTTCACCTAAGCGGCCACGAACGCTCCGAGAGAAAGACTGCGGAGAGGACCGCGAGAACAAAATCGAGTCCAGCAAAT
CGGGTCGGCCAGACGACGAGGGCAGCCAACAGACAAGACAGAGTGGTGCTTCTCCTCTTGCAAAGTGCCTTTGCCTTTTGCCTTTGATGCCAACGGATTT
CGAGCTCGGCGGTCCTTCAGGTGTCTAGAAACGACACACAAAGGGTGCCACTGTAGAGCAGCTGGGGTCGAGTGAATGAAGAGTGGCCGCAATATGCTGT
TTAGAAGTTACGGTAAATGGGGCATCTCTGTTCGAGACGGGTACCTTCATCCATTCTGTTTGGAAGGTTAATACACTATATGAGTGTCGAGTTGTGTCAA
CTGGCAAAATAATTTTCCATACTGGAATCAAGTCACTTGGAAACGGCCGAGTTTTTCAACTCGGAGTTTGGACTTATGAGCCAGGAAATGGCCAGTGAGA
ATCACTTACACCTTGACTTTGACTACGCTCAGCTGAGCCTCAGCCGGTGTCTACAGCTCTACACACCCCGCGGCTGAGCCACGACCAGCAAGGCCAAACA
AAAAGGCCACTTTTTTCGTTGCCTGGCCTGGTGGTGTGACAAGCGGCGCTGGCCAAGTGGCTGCTGCGGGCCCCACATGAACAGCCCTTCAGAAAGCGAA
GGCGACAATCGCTACTCGACGACAATGGCGAGCAACAAGCCTTGCGTCAGTGCCGCTGGCTTGCCCGGAACTCGCCGAGCACGGGCCGTAGGCACGCACA
CCAAGAGATGTGGCTCGCACTTGATATTTGTATGCAATACCGTTGTTTCTCTGACTTTGATACATCTCTTTTAGAACTGCAAAATATGATTTTTGGATAA
AGTGAAAACCATTCATTTTGACGGCTAAACAAAATATTCCTCTGATATCCGATGCAAAGAATTTGATTAAAGCATAGTTCTCCGCGTGGTGGACCATATT
GCGTATTTATTGAACCTTCTGGCTGTCTCGTCTGCATGTGTACGGTCCACTTTCCTCTCCAAGCGCATACGGCCCGCCAAAGAGCAT