Description :
From Genome Similarity Track
Location :
Scaffold_73:17636- 19282
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014786Protein of unknown function

Sequence
1646 bases(100 bases per row)
CGAGATACATAATTGATTGTTGATCCCAATCAATAATCGACTGATACCTTTTCAGCCATGGCATTCCAAGGATGACATCGAATTTGTCATCCAAATCCAG
CCAAATGAAGTCTCCTTCCATTTGGCGTCCATCATGCGTGATACGAAGTCGTGTCGCGCGCTTTATTGTCGTGACGGTGGCGCCAGTTGCCAACCGCGCA
GTAATCTTTGACTCGGAGGAACGTAATTCCTCCGAGTTAACTTTTGCTAGCTCACGAGCGACATGTGACTGAACAAAGTTGTTCGACGCACCCGTGTCTA
GCAGTGCCCGCAGAGGGGTCGTAAATCCCTCTGCGGTTATCTTCAGTTGGATGAGCCGATCTTTCGACTCATCCGCAGTCGTGGTAGTCCAGCAGCGTGC
GCCAGACACGCTGGGGGCTTGCGTCTCGTGTACCATGATCACACCAGACGCATGTTCGCCAGTAGAGCGCCCCACATCTACTGGTTGCTGACGTTTTTTG
ACTCTTCGCGCATTGAGCGCGAAGAAGCGGTTCGAGACGTTTCTCGAACACGAGGGGCGGGTTGCACCGCTCGGCACTCGTATGAGAAGTGCCTTAACTT
CTGGCAGCGGTGGCACCGCTGCTTGCACTTGTCGGCGGTTCTCTTGGGAGCCGCCGAAGTTTGAACCAATGAGAGATCCATCGGTTCCGGTCCACTATAA
CGTGGAGGGGGTCTCGCGTGCCGAAATTGCGCGGCACGGTGGGGGTTCGCGTGAAGCTGTGCTTGCTTCGCGCTGAAATCTTCCCGCAACGCTAGAGCAA
TGGCTTGCTCTAGCGTTTCCGGGTATTCCCGGAATAAGTAGGTCTTGACGGGACCGTCCGTCAAGCCTTTCATGAACGTGGCGACTTGCGTCGCCATGTC
GATTGGCTCTGACGCGATACTTGATACCAAGTATCGGGCATGTTGGATATACGCGTGAAGATCGCGTTTATCCTGTCGGATCTCAAGGAATTCCGTGCGA
GTACGGAATTCCGACTTTGGTGGTTCAAAAGCGGCTCGAATGTCGCTTTTGAATTCCGCAAGCGTGCGGAAACAGTGGGGTCGGCCATTCGTCGACCGAA
TGCCCAGCTCTTTGCTCTCCCAGTGAGCTTAGATATCGCGAAATCGACCTGCTGCTCTGGGTCATACATTTGTCCAGAGCGAATTGCGGCGTCGATTTCA
ACGAACCATCGGAGGAGAGGCTCCTTATCTCCTCCGCCATACCTCGCGACATCAAGCTTTACAGCTTTCTGTCGTGGGGGTTGTACCTGCGCAGTAACTG
CGCTGGTTGCTTCTCTTCCACGCTCCTCTGCCTCCTTCTGCAGGAACCCAATCGCTGTGAGGCGATGTTGCTCCGGCGGACAGGTGGCAAGGATGGCGAA
GATGGCCTTTTCGCCAACGACCTTCCCCAGTCGTTGTAGAGTGCTCCACTTGAGATCACTCAAGTGGGGGCAATCATCCTGCGTGATTGTCGAACTCGCA
GTTGACGCGGGATCGACTCCCATCATGGTTTCTTCGTCAGCATTCATTGCTGACGGCTTCTCGCTCTGTGGTTGGACGGACCACAAAGTGCTACCAGGTG
TAACGGGATTACTTGTTACACGGCGTACACGTGCTTTGAGGAAGCG