Description :
From Genome Similarity Track
Location :
contig_179:17635- 22669
Transcript NameFunction/comments
g11408.t1necrosis inducing protein NPP8
g11409.t1hypothetical protein PHYSODRAFT_309744
g11410.t1hypothetical protein PHYSODRAFT_469873

Sequence
5034 bases(100 bases per row)
GGCGCACAGCAAAGGTAGAGCGGGTGTCCTTGTATGCTTGCCTACTGTTTGTCTGCAATCCGTCCTATCGTTAAGATGTGATTCGGAACACGACGAGATG
TGCTGCTTGATGCGGTACATGTACGGTACTGTAGTACCCCACGAATCGTCAATGCATCATTGATAGCGTGCTCGAATTTTTAGAAAAGAGCAGTCTCTCA
CAGGACAGGTAAGATTAAAAATAATCTAAGATACTCTGAAATTAAACAATCACCAAACTTTGGCACAAGCCGCTATTTTTCACAACTACATGTACTCGAG
TTGGCCTCATTGTCCAGTACATGTACATGTATGTTTGACCCACCTTCCTTTGAACTACGACGTCACAGGTCACACAGATCACGGGAGTATATCGTATCGC
ATGCCTTGGTCTAACAGCATGATAACTTTTAATGATCGGGTGCAAGCTGTCTCTTTGTGTCGGACCCTCAAATGAGTCGCCTTGACGACCCGGAGGGATA
GCCTAACCTACTCTTTTTCTCCGCTCCATTCCGCAATTCTTCCACCGAGACGCGAATCAACAAGCTCCAGGTGTGGAGATGAAGACCCACGTCGTCCTCT
GCGCCGCTTTGGCTGCCATTGCCGTCGTACAAGGCCAAGAAACGTCCAAGACGACTGTGAAGTACATCGACTACTCGTCCTTGAAGAATTTAACGAGAGC
TCCGACTGTGCAGCAAGACACGTCGGGGTCTCAGGACCAGCAGCAACAGCACAACAACAACCTATCCCGTTAGTGACGCCTACCAGCGGCCGGACCCACG
CGCGACGGAAGCTCCGACACTGCACCGACGCTACCCCTACGCCGGCACCGACTCCCGCCCCGACTCCGGCACCAACACCGGATCCTGGTCCGTGGGTGAC
CGTGTGGATTGACCACGACCAAGTGAAGCCGTTCGCACAACCTGAACCTATCACGATCTCCGAGAAGGCTGGTGTCAAGTTCAAACCGCAGATTCACGTC
ACCAACGGATGCCACCCGTACCCTGCAGTGAACGAAGCTGGTGAGACCGGTGGCGGTCTCAAGACGAAGGGCGCTCCCAGTGCTGGATGCAAGGGTTCCG
GATGGGGCTCCCAGTGTACGGACGTTCCGGTTGGTACCAGGACGTGTGGGCCATCATGTACTCCTGGTACTTCCCAAAGACTCGCCTTCTACGGGTTTAG
GCCACCGCCACGACTGGGAGCACGTCATCGTGTGGATCGACAACCCGGATGTGGAGAATCCCAAGATCCTGGCCGTCACCCCGTCGGCGCACAGTGGTTA
CTCCAAGCAGGTTCCGCCCAATGCCGACTCCGTTGATGGTACGAGTGTCAAGGTCGAGTATAAGAGCAAGTGGCCGATTAACCACGCCCTGGAGTCGACT
TCCCAGGGAGGTGACTTCCAGGACCTCATCATGTGGGACCAGTTGTCTGAGAATGCCCGCCGGGCTTTGAACTCGGTGCCTTGGGGCGATGCGAACACGC
CGATGAACGATGGCAACTTCCAGAACAAGCTAGGCAAGGCTTGGCCCTTTTAAATGTTGGTGGTGAAGGTAGCCAACGCAAATGTAATAACACCAGCGTC
CGCGTATGGTACTATCTATCTCTTGCGAATCCCCATTATTGAAAGTTGCCCTTATCTCGGTGAGACCGCACAGCTCAAGATCAGTTTCGTCACTTCCCGG
TGGTTTCGTGGAGATGCCGTGGCCTTGAAGCGACGGCCAAAGCTCAATAGGAGATTGCAAGCACACTGAACCAGCATGGGGTGCTGTTCCAATAAGCAGC
AGGTGGGCGTCAAGGATGAAGCTGCATCGCAAGGTGTGGCACCAGCTAGTTCTCGCAAGTGTCGAGATGTGCTCTGCGTCCTGTTTTTCGCGGTGTTCTG
GGTGGGCATGATCGCTATCGCCGCCGTTGGGTTCATGCACGGTGAGCCCAAACGACTGCTGTACGGATCAGACTACAACGGCAGCACCTGTGGCACTGGG
GAGCAAGAAGAGTATCCGTTGACGTTTTATCCTCGGATCACGCAGGACTTACTGGAACAAGCGTCAAACCCGTCACTGTCTCCGGAAGACTTCTCGTTCT
ACGGAGTCTGCGTGGAGAGCTGTCCGGATGCTGGCTCGTACATTTGCAACTACGAGGCCGAGAACGAGATCCAAAACGATCCGTCACTGACGACCGATGA
AGAGCGAGGACGAGAACGCAAGTCGAGGGCGACGAGCTTGTTGGTTCTCCCTAGCGAAAAAGAATGTTGGCTGGTTGCTATGTCAAGTGAGCAAGTGTTT
TATCGGTGTCTTCAGCTGACGGAATCCAACTCGACGTCTGTAGAGAAGTGCGTGGTTCCTGGAGATGAACCCGAGTACTACGACGAGGTAAATGGCGTAC
AGGTGCCAAACGACAAGTGCGAGATCAAGCGAGTGATCACAACTTCGGAGGCACTGGGACCGGCGCAGGAGAACCCTCTATACTCGACGCTGCAGACAAT
GGGCGCTACCATCGGGCGCGTCATCGGTGACTTGCAGGAAACCTGGCCGGTATTCCTTACCTGCGGAGGAGTGCTGGCCCTTGTTCTAGGCTTCGCGTTT
GTAGTGTTGCTGCGCTTCTGTGCTGGGTGCATCGTGTGGATTATGCTTTGGAGTTTCGTGTTGCTGCTGTTACTCTTCGCCCTGATGCTCAGTGCGAAGG
GTGGAATCATCGGTAGCTCGGAGCTCAGTGCGATCACTGCAGAGCTGGCAACGGCGGCAGCTGCGGCTGGCGTAAACGCAACGGAAATGAACGTGACAAC
GATCGAGCTGCCTCAAACTCTTCGCGCCAGCGAGGACAAGCAAAAGGCGTACGCGGTAGCAGCATACGTTTCGTACGTTCTAGCGGGGGTCGCTCTTTTA
CTCGTCTGCTTCTTCCAGAAGAAGATCCGTATCGCGGTTGGCATTGTGAAAGAAGCATCGCGCGCGCTGCAGCACTTGCCTCTGCTAGTGTTGTTCCCTA
TTATCCCGTTTATCATGCTCCTCGTGCTCTTCGCGTACGCTGCAATCGTTGGAGCGTACATCTACAGCTCAGGCGAGATGCAGTTGGCTTCACTTGCAGG
CGAACTGGCCGACCAAGCTGGGCAAAATGTAACAGCGGAGGCAACTACGACGCTGAGCCAGGTGAGCCCTGACCAGACGATGAAGCTCTTGGTGGCGTAT
CACTTCTTCGGTTTCCTGTGGACGGCGCAGCTCATCAACGCCATCAGCATGTGCACGATAGCTGGCGCCGTGAGTCGCTACTACTGGAGTCGCAACAAGA
CCAGCGAGGAAATGGGGCCCTTCCCTGTGCTCACTTCCTTCAAGAACTGCTTCCGCTACCACTTCGGGTCGCTGGCATTTGGCGCGTTTATCATCGCAGT
AGTGCAGTTCATTCGTGCTGCACTGCTGTACCTGGATCACCAAACACAAGACGTGCAGAAGTCCAACCTCGTGCTCAAGGTCGTCATGAAGATCGTGCAG
TGCTTTCTTTGGTGCCTCGAAAAGTGTCTGCGCTTCCTGTCCAAGAACGCCTACATCCTCATCGCCATGAAAGGCCACAGCTTCTGTTCGTCCGCCAAGG
ACGCGTTCAAAATCCTGTTGAGCAACATCGCGCAGGTGGGTGCCGTGTCGACGGTAACCTTCTTACTCCTCGGCGCTGGGAAGGTCGCCATCGCTCTGAG
CTGCGCCATCGCCACGTTCGCCTACTTGGAGAAGAACAGCGACGACTACGGCGTCGGTGGCGCTCACGAGCTGTCGTCACCGCTGGCACCGATCCTGCTG
GCGCTGCTACTCGGCTGGTTCGTAGCGTCCACACTCCTGGGCGTGTACGAAATGGCCATTGACACGATCCTACTCTGCTTCTGCGAAGACAAAGAGGTGA
ACAAGACGTCAGGTCAGTACTTCATGAGCGACTCGCTCAAGAAGTTCGTGGCCAGCGTCCCGGTCTCCAAAACCGAGTCCCCAGCTACCGACATCCAGGA
GTAACCACTGCGTAGATAGCAACAAAATACACTTGCATAATGTATCGACCAAGTTGAAGTTACGGTCCTTTATTCGAGAGGTGCCCAAATCAAGTTTTGA
CCAATAGCTAATTGGGTACCTTGTTGAAAATGGGCACAAATCCAACATGGTTTTTGATGCGCGGCCGGCGTGCCGAGCTGCTGGTGGCTTCGGCCATGAC
AGCGTATGTGTTCCTGTGCCCCTTCGCTAAGGTTGAAGAGAGCTTCAACCTGCAGGCGACGCACGACTTGTTGGTATTCGGCGCTCGGAGCGTCGAGAAA
TTCGACCATTTGGAGTTCCCGGGAGTGGTGCCTCGCACATTTTTGGGCTCTTTGGCGGTCGCCAGCGTCAATGGACCCATACATTGGGTGTTTATGGTAC
TCGGTGCCCCAAAACTCTGGATGCAGGTAGCGACGCGCTGGGTGCTGGGCATGGCGACGCTGGGGGCTCTGATGTTCTTCAGTGACGGTGTGGGGATGCG
CTTCGGCCGAGACACGAGTCGCTTCTTGCTGCTCATTTGTGCGTGCCAGTTCCACTTGGTGTTCTACATGAGCCGCACATTGCCAAATGTGTACGCATTG
GTACGTTGGTAGAATGGGAAGAAGAATACGTAGAACCAGGTAGAGTGACATTGTGTGTTTGCTTTTGTAGGTGTTGGTGCTGTTCGGACTGGGCTTCTGG
CTTCGAGTATGGTGTCTTTTGATAATTTTTGACGATGGCAGTTGGTTGACTCGGTGTTTGGTCTGTTGTTGACGAAATGCAGGACAAGTGGCAGCGCAGT
GTGTTCCTGTTTACCTTTGCGACGGTCGTGTTCCGCGGAGATACCATTGTGCTCTTCGCTCCATTAGTGTGAGCATGCTGTTGTCGCGTCGGGTCTCGTT
TTTCAAGATGGTGTGGTGGGGCCTCTCGGCGGGAATTGTGTCGTTGGCGGCGACGGTTCTCGTGGACTCGTACTTCTGGCAGCGCTGGCTGTGGCCCGAG
GGCGAGGTGCTGTGGTTCAACACGGTGCAGAACA