Description :
From Genome Similarity Track
Location :
Scaffold_172:1763- 3358
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_172-fgenesh-gene-0.0Transmembrane protein

Sequence
1595 bases(100 bases per row)
CTGTACGGGGCAGCCAAGATCGGCGATGTGAATCAAGCGCGCGCCAGTGTGGCAGATGCGATCGCGCTCGATGGCCCGGACTTCGCTGCCAAGTGGTATA
TTCCACCTCGAAGGCTGCTGCTCTTCGCATCCTGCCGTCGCAACCCGCTGCATGTAGCTGTCGTGTTCGACCAGCCCGAGGTTGTGCGCGAACTTCTCGA
AGGTCCCGCCCGATTCGATCCAAACACGCTCGACCAGCTCGAACGGATCAAGCTTGGGCTCTCGTGGATGTACCGCGTGCTGTTCCGCGTCGCCGCACTA
TTCAACCGAGGCGACTTCACGACCGACCGCACGACGGATGAGCACACACGTCCGTTTGGTATCGCAGGGCTCTTCCACAGCACGCTGCTCTCGCCGCTGC
ACACCGCGGCGACGCTCGGCAACGCCGACATGGTTCTGCTGCTGCTGCGCCACGGCGCCGACGCCAACTTGGCCGCGAGGTCCACGGACGCTCGTTTCGC
TACACCGCCGCTCTTCTGGGCTCGCACCAAGGACTGCGCGCGTCTGTTGCTGGACGCGGACGCCAACCCGCTCTTTATCCCCGGCAGCGGCTTCTTACTC
ACGGCATTCGAGGTCGCACGGCTCGCGGGTAACCGGTCAGTGGCGAGGCTCATGGAGAAGTTCGGCGGCGACGTGGCCCTCACCCCACTGCACGATGCGT
GCGCGCGTGGACACGATACCGAGGTGGAGTTTCTCCTCAAGCACGGCGCCAACCCGGACGCACTGGGTGAGCAGGTCGTGGGTTTCTTCAACCGCACGCC
GCTGCACTGGGCAGCCATGCGCGGCCAAGATGCGGCCATCCGATTGCTACTTCAGTATGGGGCTAGTGTCGACGCTCGCGATGCGTTCGGCCGCTCGCCG
CTCGCTTGGGCTTGCCTGTTAGGCCGCGTCAGTTCTGCAAAGCTGCTGCTGGAGAATGGCGCCGATCCGAACACTCGGGATGTCCTGGGAGACCCACTGC
TGTGTTTATGTGCGGCTGGCGTGACCCGCGCAGCGGTGACAAGGACATCGGCCAAGCCATCCAACTACGACGACTACAACGAGCCGACAGACGCTGAGCC
CCACCAGTACCGCAGTAGCTTGGACCCGCGCGTGATTGAGCTGCTGGTGCGACACGGCGTGGACCTGCACGCGACCAGGACAAGCAACGGCGACACGGCG
CTGCATGTGGCGCTTCGGCACGGCAACGAGACTGCGGCGCTGCTGCTGGTTCGCGCGGGGTTGGACATCACGGCAATGAACCTGCTCGGCCAGCGCGCGA
TCGAATGCACCACGTCCACAACCTTGCGCTACGCTGTCAAGAAGGAGGCCGGCCAGCGCGACGTCATGATCAGCTACACACACTCGAACTCGTCGCTCGC
GCGGCGGATCCGGGACGAGCTTGAGGCTGCGCACGTCACGACGTGGATTGACGCCATGGACCCGACGGGGATCGCCGGAGGCACCGAGTGGCGCCGCGAG
ATTGCAAACGGCATCCAGAGCAGCGCGTTGGTGCTCGCCGTGCTGACGCGCGACTACCCAGCGTCTCCGTGGTGCATGAAGGAGCTCGCGTTTGC