Description :
From Genome Similarity Track
Location :
scaffold_543:17622- 22542
Transcript NameFunction/comments
Pl_103960hypothetical protein PHYSODRAFT_313173
Pl_103961hypothetical protein PHYSODRAFT_345496

Sequence
4920 bases(100 bases per row)
CTTGATGGCCTCTTTCCTTGCTTTCCACGTGCTTTCGTGACCTCCGCGACGCATCGCAAGCTCTAATTCCTGCTCCAGATCATTGTTACGAGCGTCGAAT
CGCTCTAGTTCCGTCAGTGCGATCCACTCGAATAATGGCACAATGCTCAATGCTGTAGGAGCCAAAAGCGTCGCGGCCACTTGGCGAGCGAATCTCACAG
CACTCTGCGGAGTAGGGAAGCATTGATACACATGTACTACAATTGCTTCAATGCAACTGGCTCCAGGCGACTGAAGTGACACGCTGATGCATGCAAAGCG
CTGGCCTGTTGCCTGTGGTAAGTCTGCCGCACGGAATTGCATGGTGTTTGGACCAGCGTCACCCACATCGACACTAGGGAAATTCTCCAGTGCCATCGTC
ATTTCATCTTCTTTGTAGATTGCGAATCGACTGCAGTTCCGTCCGTCCGACAGCCCCGCAGTTTTCTCCACTGCGCAAATCTGCCGAAAAATGTTGAGAG
CTTCGTCGATATCGCGAAATTTGCCAAAGACGCGGAAGCGAGTGAATTCAGCATGACCTACTGCACTTACAGCTGCAGTCACTTTACGGAGCTGGTCTGC
CGCAGATTTCGCAGACCTTGATATCTTGCCTGAAGACAGCGAGATGGACATTCCCCTCGACGGCGGTCGAGAGGTTTGTTCTTTCATAAACCCCAGCACA
GCGAAAGGTTGACACACACCGTGAACCGGATCCCATATTGTCGCTGCATGTGGTGCTGCAGTGGTGGATGTTCCTGCTGGTCCATTCTTACTATTTGTAA
TTGCGCTCTCAGTCTTGTCTGAACGAATTCGTCCACAACGACGTAAGTCGCTACGATATTCCTTCGTGCTAGACAAATGCTCTTCCTTTGATGACTCTTT
GATCGAAGACACCGCTGGAAGCAATCCTTGGCCGCTTTTTTCGTCGTTTGTACGGCGATTTAGTGTCTTACTACTGCCGGAACCCGTGAGGGAATGCAGT
GGCGTCTGCACGGGTGTAGAGTCGTCATGTGCTACAGATGGCAACTTCGCCCAACTCCTTCTGTGCTGTAATTTCGACGCAAGTGCAGTCGTTGTTGATG
ACCTTCTTTGTAGCATTGATGGTCCAGAAGCACCTCGACTCAATTCTGATTGCAAATTCAGCGTATCATTATTGTCTTGAGGAAATGAAGCGTCTTCAGA
AAAATCAACTTGGTCATCAGTTTGAGCATCAGTTCCCGATCCACTCTTGAGACTTTCATCCTTAGAGCTTCCACTTGCTTGTCGTACTGTTCCTGTTTTC
GCTGCCCCTCTTCGACGTTCAAGCATGAGAGAACCAGGATCGACGAGTGTACGAGCTTCACTAAGTGGTAGTAGCGGTGCAGATTGCGATTTGCCTAATG
TAGTGCCCTGGTGAATCGAGATGGCATCTCGATCAGAGCGTGCTCCAACAGACTCAAATGAATGGTGCTGATTTTCAGCCATGACACTGCTGATGAAATC
CTTCTTGTATTTCTCCCATGCAACAGACTTTAGTGCCCGGCTCTGGATGGATTCGCGAATATACCCATTAGACGAGCGCTGTAGACTTGCACGAGCCTCT
GTCGACATAAGATGAAAGATATCAAAACGTGAGAGCACTAGAATTTTCATCGGTGACTCTGCTAGAATTGAGTAATCGCGGATAAAAATGTCGTTAAATT
TTCCTGCTGATGCCCTGTGAGCATAATGCACGTTAGTCTCAAGTCATGAAGATAATAACAAATGAATAAACTTACTCCGCGCAACCCAAAACAGAGTTGG
GACCATATCTTCCCAAATCATAGGTCTGGCGCGCATTAGTGATTGGATTTTTGCCATCATGGATAATTCGGCACTCCCCTCGAGTCACAATAAATAATTC
ACTTGCACGTGACCCCTGTTCAATCACAAGCGTGTTAGTAGATATGAAACGCCATTTCATTCAATGACTTACCTGCTTGCAGACCTCCCCTTTATATGGA
ATGTACTTTTCAGTCATGACGGAGCACATGCCTTCAATGGTGTTGTCATCCCACTCGGGGCCAATAAAATATGGGTTCTTTCGCAGCATCTGCGCGTACT
GTGCGTGATATTCGTTTTGATACTTTTGGATCAATGGTTCATACTCGTCACGACCTAGGATGAGTAACTCGCAGAATTCAGTGCAGACCACCGTGGCACG
CCGAACACCGTCAGCCTGTGAGAGAGCTAATTCACCGAAGTACTCACCCTCACCGAGTCTTGATACGACATTCTCTTTTGTTTCCTCGAAACGATTTTTC
GCTCGAACTGATACATCAACACATCCCGTAAAAATGATGTAGAAATGCCGCCCCACTTGACCTTCAGCAAAGAGCACTGTATTTGTGACAGCACTAATGA
GCCGCATGACCTTGCAAAGTTGCTTTCGGACTTCAAATGAGAACCGCGAGAAGAATTTAACGCTTTTTAAGTACTCGACGGCGAATTTCAGATCTTTTTC
AGAGCGTTGTGTGGAACCTCGCATGAAAATATTGCGTACAATGTCTTTGTTGCTCCGAAATCGTTTGGTAATCTCGAGCGTATTGTTGTTACTGGAGTCA
TGTGACTCCTTGAGTAACTCGGTGAACACGACGCGGTTAATGAAAACAAGCTCTGTTGGAGCACTTGAAATAACCACAGATGCTAGAGCAACAATGATTT
AATAAACAACGCACTACCAACAATCGAGAGTTTAAAAAGAAATCTTACCTGAGCGCACATCGGTATTGGAGAGCAAAGCTCGTTCTCCAAAAGTATCTCC
TGGGCCTAAATAGACTAAATGAACTATCCCGTTTGTACGAGCGGGATCCTTTTTAATCACTTCCACTAATTTGAACAATATGTCAGATGTTTAGGAGAGG
CTTTCAAACGTTTCAAAATGTGCATCTACCGACCACGACCGGTGTAGACGAGATAGAAGCTGTCACCATCATCACCCTACCAAATGAAATACACATGAAA
TCCAATGAGTGTGATACAAACAATAAAGTCGAGTAGGGTACTTGGGAATGCACACCTCGTGAAAAACATAGGCCCCCTTCTCCGTGTACGTTACGATCTC
GAGTGATTGATACAGTCGGTCCAGCTGCATCACACAGGACCAATCAGACAAAACGAACTGAAGCAGAAGAGGGGTAAATTCGACTCACCTTAACTACAGA
TAAGCAAGAAATGAGATGAGAATGTCAGAGAGCAGGCGTAGCACCAACCTTTGTGATGAATCAAACGAACATGCATCTAGGTTGGAGAAGAATTCCAGTA
GTTTAGATGATGCGAAGAGAGATTTGAGCTGCAAAGCTGTTAGCCAACTGAAACAAATAATTTCCGCCAGACTCCACTCACCACATGAATGTCTTCGAGC
GTTCGCTTCCCTGTCGGTTTACGAAGGATTGTGCGGCTCAAGTTTATCTCGGGGCTCTTGTACATGATGGCCCGCAGGAAGGCACCATCGCTGGCCATCT
CCTCCATCTGCGAGGCCAGCGACCTGCGCCTGTTAGACGGCATATCTCCACTCGCAGCGACATCCTCCTCCTCCATCACACGTAAAGCGCCAATGCAGAC
GAAAATAACCAGTGTAGCCATCTCTTACCACTTCAATCTTCATATTACATTAATTCACTATAAAATACGATAAATACTAGTATTTAGACATTATTCTTCT
GTCACTCATGTCGAAGGACTTGACATGGGTCGATGAGGCCGCACGGCGTCTACGCGAGCAGTTTGCAAGCGACCGCTCTGTCTCCGTGTATGAGGCACTC
ACAGCTCATGTATTAGATGCAGCCACCGGCGGCGCGTTGTTCCTGGGCGGTGTGTCGACTGCGCAGGTGGTGCAGAAGCTGCTGCGTATCGGCTCGGCCT
CAAGCTTCCTGCTACCTCAAGCGCTGGGCGCCACTGCTGTAGCCTCTTCCTCCGTCCTCGCGCTGCACTTCGCCTCCATCCCGAGGGAAATCTACCAGGA
GGTAGCAGCGCAGAGTCGACGGACCAATGAGCAGCGTGGATGGAGTTGGCTTGTGCTCGGAGCCAGGAACCTGCAGTCGTCCACGGCCTGGAGATTAGCA
CAAAGCAAGCTTCAGGAACGTTGGGAGGATCTCCCGCAGGCTCCGTACCCAGTTTACATGGTCATGGGGTTGCTGTGTTTCAATCTGCTGGGCGGTCGCA
TGAGCGCGTTGGCGCCCTCTCCTTTTGCTAATCTGGGGGCGTTCCACCTCAAGAAGGCGTCGCTCCCAGCCACGGTCGAGTACGCCACGAGTGTGGAGAG
AGGCATCATCCAGGAATTCGGCCGCCTCTATGGTTGCCATACGTGCGGAGTCAAACACGGCGTGCGGTACCACGCAGACCACATGCCACCAAGATTGTAT
GTGTTGATAGTGTAGTTCACTATTGTCGTATCATTCCTGACCTGTTGTTTGTTGTTGTGCTGATGTTTAGAGTGGCCAAGCGTACAGATGAGCAATTGTT
CCGGAAGTTATTGGGTCGAAAGACGACCTTCCGCTTCTATCCGCAGTGCGAACGGTGTTCAAACCAGCAAGGAAGTGTCGTGAAACAGTGGAAGTCGACG
CTGAAGATGCATTTACTATCGTTCCGGGCGTACCATTCAACTGGCCTATGGCTGGTACTGCTTTGCACCGGTGGCCTCTATGTTGGCGGCTCGAACTTCC
ACGAGACATCGGAGGTGTCTGCTCCGATGGATGATGCTACTGAGACTCCGGGTGCTTTTACGTCGTCGGATTTCTCACTGCTGATTTCATTACGAGAACG
AGAGCGAAAGTTGCGTCGTGAACGAGGCAAGCAAAGCAATCCAAGTCAGATCGCTGCGATTGATAAAGAATTGGATGCAGTAGCCGAGTGCAAGACGGCC
GTCAAAGCCGACATCAAACG