Description :
From Genome Similarity Track
Location :
contig_124:17616- 22904
Transcript NameFunction/comments
g11451.t1conserved hypothetical protein
g11452.t1hypothetical protein

Sequence
5288 bases(100 bases per row)
GGACCGCGGTGGAGGTTTCTGCGAGGTGCACCGTCGTGGTCGCCTCTGCAAGGTCGAGGGCTGCAAGAAGCTGTCCCGCAACCAGGGCATGTGCACCATG
CACATCCGCGAGGAGAAGCAGGACTCAACCAACTTCGATGCTCCCATGAAGGCCGAGTCTGCTGTCGCTCTGGCTGTCTAAGGATGATCGTTGCCAGATC
TCCTATTCTCGATCCTGGAATCCCGTTCTTCCCTCTCTACAATCTCCGCGTCTTCGTCGTCCCTCATTCAAAGGAAGATGAGGAGGGGAAGAACCAGAAG
TCGATGTCCGACAACTCGAGCTGTCGTCTATCGCTCGAGTTTATCTGTCTCTATGTCTCCAGTTTGTATTCATCGGCGTTCGTGCCAACCAGTTTAGTCT
ACGTGAAAGCCTCTGTCTCCGTGAAGTGTCCAGTATTTAACTCATAATGCGCGATGAATGTATGAACCTGTCGACCCAAGCATTTCTTGACTTTGCCTCA
CGTTTCCTCCACACCTTGCAGCACCTCGACATTTTCTATCTGTTTACGTCGCGTCGATGACGGCCATTCAAGGCAACGAAAATGCGGTCGCCAGGAGCAG
CGGCGAGCATTGCAGATGTTGGTCGTTCTCGTGGAAAGCCCCGTTGGCCGCTTCAAGCAATGGTGCCAAGCTCTCCCACGCTGCCAAAGAAGCGCTCGAA
CACTCTGTCCTACCCTGCTGTATGGCTTGGCGATGGTTGCATGCCCAACAGCCGACACCGATTGGAATAGAGCACAATGCCGATTGCACAACCTCATAAT
ACTTGCATTGGTTTGTTTACGATAAGTGTCAGTCAGACAGTAAGTACATGCTCCGTGGGCTTCGACGACGCTTATGGCACGCCCCCGGACAAAACGGCAC
TGGTCTTGGGCGACATTGAAGCTGTGGATGACACCTCGTCCATATCGTCGTCCTGCGGGATCTCCAGGTGAAGCACCCGAGCGTGGTGAATTTGACGAAT
CGGCTGCGGGTGGTCGATCTGCGGCGGCATGGCTGTCCGGTGCGGGTGCGCGGCCTTGCCATGGGTGACGTGGCTGTGGTGGCCCTGCGGCAGCTTGGCA
CTATGGTGCATCTTGCCGTGCGGCGCCTTGGGCTCCTGCTTGGGCTCCACGGGCTTCACCGGGTTCTTCGCTGGCGAGAATTTCGAGTACAACCCGATCA
TCTCCTTCTTCATTTTGGCCTGGTACTTGCTGTGCTCACGGCAGTACTCGGTCGTGAAGTTTGCAATGTGCGAGAGCAGCACGTCCAGCTCCTCCTCGGT
GTCCTCTTCCTCGAAGTACTCGAGGAAGTGCGCCTTGGCCGCGTTCAACTTGTCTAACAGACCCTGCAGAACAGAGAGCTCCGTCTCCACTTCCTTGCAA
AACTGCTTCAACGTGTTCTTAGAAGTCGCCATCGCGTCCTTGTCGGCGTCGCTAGCAGTAGGACTCGGTACTGTAGCCTCAGCCTCGCGCAAAAGCTTCT
GCCATCCCGCCTCGAGTCCATTCTTTTCCGACGCAAGCGATGCGTACGCCACCTTGCTGCACTTGGAAATGAGGTCGATGTCATTGTAGAAGTGTGCAAG
GTGGGGCACGTCGCGCTCAATCGATTGCACCACATACTGCAAAAAGGTGATGCCACCCACGAAAGCCTTCGTCTGCGAAAACTTGACCAGGGAGCCCAGC
GAGAAGGCGTCGACGCCTTGATGTTCGTCATCGCCGCCAAAGTTGAGCAAGTTTCCAATCTGGAGAATATAATAAATAGTTGGCGTAGTTCTGCGCTTGA
GCACACCTGGTACACGCCTCGGGTCACGAGGTCCAGCGACACGCGCAGCTCGTGCACGCGCGACGGGAACTCCTGCTTGAATACTAGACATCCCAGTTTC
TCCTGGAAGCGTGGCACACTGCGCACTTCCACCAGAAACTGTTCGGCAGTGCCGATTGTTGACACATCGCCGTTGAAGGCGTTAATGGCCTCCATCTCCT
TTCGGTCGGGCCACATGTCCATGAGAGACCGCACTTGCGAAGTCGAAAGCACCGTCGAGTTCATCGCCAAAATCTCGCGCTTGAGCTCGGGGAAGGGCAT
TTTTACGCGTGCCAGCGTGATGGCGATGTTCTGCGATTTCTTCATATCGATGAGCTGGACCATCGCCTTCTTCTTCTTGGCGGCAGCACCCTCAGATTTC
ACGGTGGCAGTGCGCTTCTTGCTCTCCGTAAGATCCTTCACGAACAACTTCTCGAGCATAGCACGGCTCTCCTCGGAAATCTGAACCTGCTCCTTCGCCT
CCTCCACGGTATCGCCACCCCACAGACTGTCGCGACGCGTCCGGTGTTTCTTCCCTTCCCAGTGCAGCTTCTTGCGGATCGAGTCTTTGCGTTTCAGCGT
TTTCCGCTGCGGTTCCTCAACAGGAGCGGCAGCACTCCGAGGACCGTTCAGCTCCGCAGGGTCGAGTCCCGCCAACCGCATCTTTTGCTCCACCGCGCCG
CGCGGCAAGCCCATTCGAAGCATCTGAATCTGTGAGTACTTGTGGTATTTCTTGCGGTGGGCGACTCTTTCCTCTTCCGAGATCTCCGACGCAGCTGCGG
GCTTCGGCTCCGGCCTCTTCGGTGGCCCCTGCAGCCATGCCGGGTCCACACCGTCCATGCGCATCTTGTGCTCCACAACCGACGGAGGAAGACCCACCTT
CACCATCTGCGAGTACTTGCCGTGTCTCGCCTCGTACTCCTTCAGCTGTGCCTGGTACGCTGCCTCGGCTTCTGCGTCGAGAGCGGGTGCAGGTGTCTCC
GGCAGGGGCTTGTTCGGGTCCATGTCCAGAATGGTCGGGTCCACGTTCTCACTCTGCATCTTGTGCTTCACAACAGGAGCGGGGAGCCCCACCTTCAGCA
TCGTGAAGTACTTTTGATACGTTGGGTGATCTTTCAGCGGGGTTTGGTCACCACCAGCTGCGGGTGAGGGCGTGGCAGCTCCTGCTGTTGCTGCAACAGG
TGCTGGCTGGATCGCTTGGCGCTGCTTCAACATCGCAGCCAATGGATGTGCGGCCCCGCTCGTTTCCTCCTGTGCAACCGCTGGTGCCGGTGGGGGCGAT
GGCGCCGCTCTCCTCGCTAGCATGGCCTCCAATGGATTAATCTTGTTGGTCTGGGTGGGCTCATCGTCCGAGGCTGCGGGCGGCGGTGAAGATCGCTTCG
CAAGCATGGCTTCCAGTGCGTTGTTCTGGCTGGCTGGCACCTTCTCCGGGTCAACGCTATCCGTTGGCGGAGCAACTCGCTTTGCAAGCATCTCAGCCAG
CATGTTACTTCTAGGTGCAATGGGCTCGGAGATCTCCCGAGAGTCCTCTTCGGGTCTTGATACTGGAGGTTCCTGTCCCTCCTCATCGGCCTCGTCCGGC
TGGGAGAGTACGCGATTGACGAGCATATCCGCTACACTAGCGTGTCTGTCGACACCCGCGGGCATATGCCGCTGCGAGAGCATTTCCAGCAGCCCCCCAC
CAAAAAAGTCCTCGCTGTTATTTCTTGACCTTGCCGGGACGAGTACATGGAGTCGAGGTCGTCCATCTGATTGTCGCTGTCCTCGTCATCGAGTCTCACG
TCGGCCAGGAAGTCGAACGAATCGTATCTCCTACGCTCTTTCTTCTTCTTCTGGGGGGTTCTTTCCACGGGTTCTTCGTCGGGCTGTTCCTCCTCGGCCT
GTTGCCTCGCCAGCAGCTCCTCGAGCGCGCTCTGTAATCGGCCACGGCCTCTTACTGCACCTGTCAGTTCCTGCTGGTTGTCTTCAGAAGACGTGGAGGA
GGTCGCGGAGGACCCCCGACTCTCCGGTGCATTCCGGTCCACGAGCTCCCGCACATCGATCGCCTTGTCGTCGTTCTGTGCGGCTTTCTCGTCCTCGGCG
GCGCTGCCGCTATTGTTGCGGACGTCCCCGCCGTTGGGACTGGTGGACGTCGTGTGCCGGAAGAAGTCCTGCACCTTTTGCCGGTCGTTCCAATGTGTGG
AAGTAGCTGTGTGTGTGGAGGTGGCGGTTGCTGTACTGGTGGTTGCGGCCGTCTGCGGCTGGCCGAAGGGCGTGCGCTGGAAGCCGCTCATGGGCAGGCC
GAACTGCAGCCCCTCGGCGCGGGCCGACGGGCCCCGCACCAGGTGCGGCAGCGAGGGCTCCGCTGCCGAGGCCGGACTGCGCTTGTCGGCGCCCATGAGC
ATGGAGATAAAGGACGGTGCCATCTTCACCTAAGCGGCCACGAACGCTCCGAGAGAAAGACTGCGGAGAGGACCGCGAGAACAAAATCGAGTCCAGCAAA
TCGGGTCGGCCAGACGACGAGGGCAGCCAACAGACAAGACAGAGTGGTGCTTCTCCTCTTGCAAAGTGCCTTTGCCTTTTGCCTTTGATGCCAACGGATT
TCGAGCTCGGCGGTCCTTCAGGTGTCTAGAAACGACACACAAAGGGTGCCACTGTAGAGCAGCTGGGGTCGAGTGAATGAAGAGTGGCCGCAATATGCTG
TTTAGAAGTTACGGTAAATGGGGCATCTCTGTTCGAGACGGGTACCTTCATCCATTCTGTTTGGAAGGTTAATACACTATATGAGTGTCGAGTTGTGTCA
ACTGGCAAAATAATTTTCCATACTGGAATCAAGTCACTTGGAAACGGCCGAGTTTTTCAACTCGGAGTTTGGACTTATGAGCCAGGAAATGGCCAGTGAG
AATCACTTACACCTTGACTTTGACTACGCTCAGCTGAGCCTCAGCCGGTGTCTACAGCTCTACACACCCCGCGGCTGAGCCACGACCAGCAAGGCCAAAC
AAAAAGGCCACTTTTTTCGTTGCCTGGCCTGGTGGTGTGACAAGCGGCGCTGGCCAAGTGGCTGCTGCGGGCCCCACATGAACAGCCCTTCAGAAAGCGA
AGGCGACAATCGCTACTCGACGACAATGGCGAGCAACAAGCCTTGCGTCAGTGCCGCTGGCTTGCCCGGAACTCGCCGAGCACGGGCCGTAGGCACGCAC
ACCAAGAGATGTGGCTCGCACTTGATATTTGTATGCAATACCGTTGTTTCTCTGACTTTGATACATCTCTTTTAGAACTGCAAAATATGATTTTTGGATA
AAGTGAAAACCATTCATTTTGACGGCTAAACAAAATATTCCTCTGATATCCGATGCAAAGAATTTGATTAAAGCATAGTTCTCCGCGTGGTGGACCATAT
TGCGTATTTATTGAACCTTCTGGCTGTCTCGTCTGCATGTGTACGGTCCACTTTCCTCTCCAAGCGCATACGGCCCGCCAAAGAGCAT