Description :
From Genome Similarity Track
Location :
Scaffold_153:17614- 19901
Transcript NameFunction/comments
Phymu_g5623protein kinase
Phymu_g5624hypothetical protein

Sequence
2287 bases(100 bases per row)
CAACCGCGTACTTGGCGGGAGTATTGATCCCCACGATGAACAATCTCGTGTTTTTGATTGTGTCCCTGTGGCTGGGCTTGCTCTGCAGTCGGAGTCGTAA
ACGAGTGCTGCGTAGTGCGCCGTGTAGCATCAGCTCCAATCTGAGTAAGTGTCACTGTGTATTCTACAGAGGTTTGGCAATGTTGCTTAACGCACTCTTG
CGTGGTTGCTGTGTCCTACAGAGTCGGCATTTATGCTCCCGTGCTACGAAGCGATCTGGTACACGATCGCCGCGCTGTCAGCTGCTGGGCTGATTCTGTA
CTTCGTCAGCTTCCAGGCATACAAGAGCGACAGTGGCGAGACGTACAAACCACTGACCCTGAACGATGACCCTAAATACCCGTGCACCCTGGTTACGATG
CCTTCGGTTTGggtgctgcagttgctacCGATGCTCATGATCCAGCGAAGTGTCTCCCAAGAAGCAGTGCTACGTGCAATCCTGTACTCTGGGGCAGTGT
GtgtcatcctcgtcatctgCAACATGACGCTTTACAAGGTTGGCCATGATATCGCCGACGCCATCGGGATGACTATCCACGTGCTTTTGCTATTTTTCTA
CTTCTGGGCCAAGTTCGCCTTTCACGCTCGAGCCACCTTCGACtttttcttcgtcgctgccgtcatCACATCACTTGTAAACATTACAAGTGCTGTCATG
GGCCTCGCTCATGCTGATGCGACGACCACGCTGCCACTTGTTCACTGCGTTGTAACTGGACTGGACTCTATCATCGTCGTAGCTGTCTTGCTGTCCCTAC
GTGCTGATACCCGATACTGGCTGGCTATTGACGACAACAGCTCTGGtatgacgtcgtcgtccagcgctATGCGTCGTTACGTGAATTTGCTTTCGGAACG
TGGTATGATCACAAATTTCTCTACGCGAACGTCGGTGTACGATGTTCACCACATGATCGAAGAACACAGACACAACGTTGTAGACTTTTcagcgctggcg
ctggactgCATTATTGCGCAGGGCGCTACGTCCATCGTGATGCGTGGAACACTGCGTCGGAGCACACCCGTGCCTATCGCTCTCAAGATCTACACTGATG
TGCAGGTGACGAACGAGGAAGTGCAGCGATTCTCTCGGGAGACAGCACTCAACGTGCAGCTATCGCATCCCAATGTTGTTCAATTCTACGGCCTCTGCGT
GGTGCCGCCATCTATCTCGCTCATCTTTGAGTTTTGTGAATATGGTGCGCTGGACGTGACATTGCGCGAGAACCCCGAGATTTGGACGCTGGCAGCGAAG
CTCAAGGCGTGGCTGGATGCGTGTCGCGCTGTAGCTTATCTGCACAGCTTTTCGCCTCCGCTATTGCATCGTGATATCAAGACCGACAACTTTTTGGTGG
GCCAAGACTTCCTGATCAAACTCGCGGATTTCGGTGAAGCCAACTTGCTTCGACCGAGGACAGATGGCACGATGACGATCGCCGGCACTGTGGACTATAT
GGCTCCGGAGATGATCAAAGGTGGCAAGACGGCGCGTTACGGCACCGCCGTTGACGTTTACAGTTTGATGATCACACTATGGCAGATTATGGTGCCTGCA
CGCAGTCCGTGGGAACACAAGTCTCATCTTGAAGTGTATCGTGCCGTGGCCCATGGAGAGAGACCTCCTCTTCTCCCTACTATTCCAAAGGCATGCGCTG
AAATCCTCGAAGCTGGCTGGGCTGCCAATCCGAGTGATCGTGTTGCTGTGGAGGATATTATCCCATCGGTCCACCGCCTTTGGCTGCTCGCAATGCACCA
GAAGCCTCTCAAGCGCACGAAGCTTTGAGGCCGACGGCTAAGTACTAGACCACGTACGTTTGTATCTATATTGAAAATTTTGTTGAGTACCTTGGTTTAT
CGGACTACGGAGCTACAAATATTTATCAGGTGTTACAGCTCGGTTAGTGATCGAGGCTCCGACGGGGCTCCGTCTTCTTTTTCACGATGGCGGTGCTTTC
GTGACGAGCCGCTCTTTTTTGTCTGAtgtgaagaggaagaagctgaagtgTCTTTCTCTCtgtctttcttcttcttcttgctgatCTTGGACTTGTTTTT
GCTAGAGCCATGAGTGGCATCGCTACTTGAGAGTGATTTTGACGACACTCCTTGCTTTCGTAGCAACTTGTCTCGCTGAGCTTGACGTTGTCTCATCTga
agtttcttcttgcgctcttTTTCCTTTGCCTGCATTTGCTGCCAGTCCGCGTCGAAAGCTTGGGATTCAACCTTCCCTAGTTCTGGT