Description :
From Genome Similarity Track
Location :
Scaffold_809:1761- 2818
Transcript NameFunction/comments
Phyta_totarag10820conserved hypothetical protein

Sequence
1057 bases(100 bases per row)
TCTAAATTATTACGGTGCAGGGGCAGCCTTCACCAAGGAGTTCGAGGTGGAACTAGCGGAAGACTGCGAGCCATTGAGCCAGCAATGAATCGACgatacc
cccccccccccNcgatccccccccccccctcgaAGTAGCAGCAGGAGGAAACGCAAGTAACACAGCAGTGGAAGAGCGAAAGGCTATTGCGCCGAGACAT
CGATCTCTGGAACGAGCTATTCCCAGAGCTCGCCGTGAAGTCTACTTGAAGTCACCACTGCTGACACCGAGAGTTTCCCCACGATCCAGGCTCACCAAAT
GTGTGTCACGCAGGCAAGAAAGCATGACGCCTCGCTTTCCAAGAAGcatggtgcagtggttgcatACTACATAAAGTAGTGCATTTGACTGTCGCATTTC
ACATTTCTCCCGCCCAGCAGCCCCAGTAAACAACAGCCTTGATGGACTAATTCTCTTCATCTATGTATTGCGCGGCGATGGCTCTCCGCAAGAGCAACAC
CGTCGTGTGTACCCAATCGCCATTTCACCACTCGATTTGCAGTGCCTGTAGCGCCATTACGTACATTACGTACATTACGTACACGGCACGCGTTTGCAAG
CGTCGAACATCCTCATCGAAATCGATACGGAGCGGACGGCAAGAAGTCGAGTGTAAATCCTCCTCTCGCCTCGCTTCTCTTGACTCAAGAGTCTTGAGGC
AACACTACAGTCCATTTCAGAGCCATTTTACTTCCGTATTTCGACGCGAGCCTGCGCCGCGCAACGGACGGCAAGCTCCTACGCGTGCATCGGCGTGTGC
CCACACTCGGATCGTGGCCTTCTCTTGAGCGCCAGTGCCTGGCCTTCGTGGGGTTGTCCAATACAAACATCCAGTCTATTTCCTTTTGGTCTGTGTAGAG
GCCAGCCCATCAACTCGAAAAGGCCAAGCAAGCCAAGAAAAGCTCCGGCaagccagccagccacaGCTCGAGCCGCTCTcatgacgaagctgaagctgga
gaagcagcggtCACTCTCCTCCGCGAGCGGCGGCGGTGTGGGGCGCGCCACAACGAA