Description :
From Genome Similarity Track
Location :
Scaffold_1:17607- 18616
Sequence
1009 bases(100 bases per row)
CCCGTACTGGTGATAAGACTTAAGGCGACCGACGTAGAACGTAGGATGCATGCGCAACTTACGTGGCATTTCAATCGTGTATGCGTTGCCTAAGCGGCGC
AGCACACGAAATGGACCGATGAACTTAGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTTGAGGTAAGTTTACCGTAGATAGTAGGACTAGGT
CACCTTCAGTGAATGGAAAAACATTTGCCCTTCCATTTTTGTCTGCGTTTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAATCTTGCACGAAACGGAC
AACCGTTTTGCGAGCCAGTATGAATTCATCTGCTGACTCGCTTTCTTTGACTATAGTGCGCTTGGAGCGCACTGTGGCAAGATCAGTGACCTGGGTAGTT
AGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGATATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGATGAGTGAG
AGCCGAGTTGGCGTTCACTCGAACGATTCTCCCCCCCCCCTCAAACTATAGTTACACTCTAAGAAGGTGGGTAGGCGTGGGTGGCGCAAGCCATTGACGA
AGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACAATTGGCAATAATTCGCTCCAATTCGTAAACGAATGGACATAACC
CCGAACGATTTCCTTAAGAACGCGGTTTGCACACTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGCGTACCGAGTGTTTCG
AACGCGGATCGCCAGAATTCTGCAATGAACCGTGGGTCTTGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGATAGATCGTGTCGATAAAGACAC
GGGCACAAGCCGATGCGTTGATTGATTCGGGTACAGCAACCAGATGTATCATTTTACTGAATCTATCAACGTACACAAGAATACCTGTATTCTTGTGTGG
GTGTGCGGG