Description :
From Genome Similarity Track
Location :
Scaffold_17:176032- 178992
Sequence
2960 bases(100 bases per row)
ATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTTCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCTTGTCTGTCTCACAATCCACGCAT
TCACCGACGTATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACCAATACCCTGATGCCCGCCTTCCA
GGCTAGCATGGTAGTGGTGTAGAACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAATCCATCCCGGTCCTCGTTGACTTTCTTCGTAGGGGG
GGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCA
TCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTTTGTGCTTTGAGGATCCGCTCAATGCGAACTCCCTTCACAAATGTTTCCTCGAGGATCTG
GGGGCTGGATCCAATCCTTCCTCTGGACCTATTGACAGCCATTACCTGGACTGTCCTTTTCCCGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAAC
GTGACGAGATCCTGACGCCCGGCCTCTCTCTCCACCTCAACACCATATTGATTTCGTAAAGCGGCACTGGCCAAGCTGTCCGCACTTGCATTCCGATCTC
GCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGACCATCACCTTATGCCGTAACAGCGTTAGGGCCGGGGCCTTGCAGTCAATCTCACC
TCGCACTTGTCTGATCACCAAGCTTGAATCTCCACAAATCACCAGCCTTTTCGGATCCTGTCCCTTTAGAAGATCCAAACCCAGCAGGAGTCCGTTATAC
TCCGCTTCATTGACGATGAGGCCCTCCGCATAAGTGGATCTGGCCCTTACGACTTCCCATCCGGGCGGTTTTTACAGCATTGCGCTGTATGCTCCTCCTC
CGCGTCGCACGGGAGCAGATCCATCGAAACCCAGGTTGTACAAATCCTCATCCACCTGCAACGTCGGGACCGGGATCTGGATCCGGCGTTTGGGCTCTTT
CTTAGGAGCGATCCTGGTCAGCGCTTCGTCCAGCTTGGCTCTAGGTGTGATACTCGCGGCCAAGACTCCCAGAATCTCGTCTTCCCCTTTCGAACATTTC
ACAATCTCCAGTGTCCAAGGGGAGAGTAACGCTGCCCATTGTCCCAACCGTCCTTGTAGACCGGCCGACTTGAACAGCCAAGCGAGCGTAGAGTGTCGAG
GCAAGATCCGGATGGAATACCCCACCAGCAGGTTATAATTGAGATCCAACACCCGTAGGAGTACGATTATTTCCTTCTCCACCGCTCCATAATTCAGCTC
ATTCGGCTTTAGCGCTCGGCTGACGAAGGTTACTGGATGGTAGATCCCCTCATGTTCCTGTACCAAGGCTGCTGAGACTACCCAGTCACTGGCATAAACT
GTCACCGTAGGTTACCGCTCCGGATCGAAATGGCGGAGGATTGGCATCGTCGCGATCCTGCTCCTTAGCTCCACAAACGCGTGCTGAGCTCGGATCCACC
GAGGCTCCACCTTCTCCGAGTCCCCCTCCGTCAGCTCTGTCCAGATTGGATCCTCTCCCAATTGGTCCCGTGACGGATCCAGTTCATGCTTAAGGCCGTC
TTCCGGCGTCATACTATGTGGATCCCTTCGTGGATCCGACATCTCCAGGGCCAGAGCTTGTTGGATTTTGATCCGGACAGCCGAAGTGGTCATCGCAGCA
AAATCCGCCTCCCTCAATTCATAGAGTACTGCTGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTGCCCAAGCAGGATTGCATCG
CCCGTAACGACTGTGGGAAGGACAAGTCTGCCAACGAAGACAGGTCCTTAGAATTCGCCTCCAGTCCCTCCTTGGAGACTCGATGACCTAAGTAATCCAC
CTTGCGCATTTCCAATAGCTCTTCACCACGCTGATAGAGAGATTTCACTTAGTACACGCCTCCAATAGGGATGTCACTTCCTCGCACAACTGATCCCACG
ATTCTGCCGGGATTATAATGTCGTCGATATAAGATCTGCTTCCTAACACAGATGGAGTCCCAGGATCTCCTGGATCTCCTGCTTCGAATGGATTCACTTC
CGTATGATCTTCCCCGGATCCACCCCTTTCGGGTTCCGGTATTCGGGTGAATCCGTAGAGGGTGTTATCGATCAGGCGTTGGTAGATCTGGGGCGCATTC
TTTAATCCAAACGGCATCCGGTTCCATTCGAACAGTCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTCACCACCCAGAAAC
CACTGGCCATGTCAAGAGAACAGTACTAGAGTACTTTATCCAAATCTTCCAACAGCTCGTTGATTAGAGGCATTGGATACACCATCAATCGGGTCAGGCC
GTTAACTAGCCGGTAATCAATGCACAGACGTATATCCACACCGTTCTTCTTGATGATGATTACCACCGGAGATGCCCACGGGGACGTTGAGAAACTGATG
CTTTTGGCTTGCAGCAGGCCCTTAATCAGATCCGATACTTTTTCTCGGAACTGAGGCGCCACCTTCCGCAACCTTTGAGCGATTGGCTTCGCGTCACCGA
CATCGATGTCACATTTGACTCCGCGGGCAGCGGGTGGTAATGCATTACCTTTGACCGATCAGCAGATGTCGGCTTTCCCAGATCTTCTGACGTAGCCGAT
CCACTTCCGCGGGTTCGGTCGCCCCTGGATCCACTTGGATGTCGTCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGTATCACCGCCATGCCTTC
TCGGAGATCCTCGGCGTGTAGGTCCCCGCCTTCATGGTAACAGACTTGTTCATCTTCAGG