Description :
From Genome Similarity Track
Location :
Scaffold_819:17600- 18730
Transcript NameFunction/comments
Phyta_totarag10866hypothetical protein

Sequence
1130 bases(100 bases per row)
TGGTGTGGAAGCCACCAGCTCAACTTggcggtacatgtaggaggATTTTTGAAGATGACGGATAAACACTTCAATTTCAACTCCAGGTTGTCCGCTGGAA
TCTCGCTCACACGCAAGTTCGGGAGTGTTCACTTTGCTGTGGGTTTATGCCCGTCATAGACGATGGCGCACTGGGAGTATATCTACAGTACGACACATGC
CATTTGCTGGCGAGGCATTAGAGCGCCCTCGTGGTAGCTCaagacgagaagaagtaGTTATGTATGGTGGCTGTGCCttttcgtcgtctccgacaTTTCA
GAAATGGTACGCGTGTACTTTCGGAAGACGCAGTTTAATACGGTCAtcgtgaaggagcagcaTGTGGCTCTCGACGAGCTAATGCACCCATTGCAGATGA
AGTACAAGagcgactcggacgatgGTTCGACCCCGAAAAGGTTGCTTAGCATCGGAAATTGAGCTCTTTTCAGTCAGTGAATCTCTACGACACTATGGAA
CCAAGACAGGCGGCGGTGACAACGAGCAGAATGTTGTGAAGAACGcagatactgctgctggacttggccTTTGTAGAGGGCCGATGAGCACGAAGTTAAG
TCGCCGACAGCACGAGTACGAAGAGTTGCTGCCGCAAATGCGCACGAATCAACATGACGAGGTAAATGTTATGGCAGTAGCTATCACGGCGCTCATTAAG
GGCGTGTCCAGGATCGAGCTTGATGTGAGCAAGGACGCGCGCGAAGAACCGCCTACACGTCCTTCAGATGTTATTGCCTGCAAGATCGGGGCTGTCTAGG
GTCTGTTGAAGGCACACGCTGCTAAAATCCAAGCTCAGTACGGCAAAAGAGGATCTATGGGCGTAGCTGGCTAAGCAATTACAAGCTCAACAATATTTTA
CTTTGATGGCGCTAGCGGACACAATGGATAAGTAGTAAGCGGCAGAGAAGACGTTTACGTGCAGAAACTTCGCatatacttcgaagtattaatagtttCA
TAGACTTAGATTGCCCATTTCTAGCTTTTTCTTCACTTACGTACTTTTGCAGAAGCTCCTCTGCCTGCTGTCGGCACTCGAGCGCATCCTGCGCTAGCGA
ATACACCCCAAAGGACTGCGGCCCAGAAAG