Description :
From Genome Similarity Track
Location :
Scaffold_2308:1760- 3979
Transcript NameFunction/comments
Phypl_g14938hypothetical protein

Sequence
2219 bases(100 bases per row)
AACGCGCCACAGATCTATCAAAGGCTGATCGACAACGCGCTCTACGGATTCATGAGTCTGTCGACGATCGCGATACTCGGAACGTCTTCGACGAGGGAGA
GCCGGGACCCCCAGGAATCCACTCCGTCCTATGTCGGAGATCGTACATCGATGACATCCTAATCGGCGGTACGTCGTGGGACGATTTGTGTTCGAAGGTG
GAGCGACTGCTGGATGTCTGCGAACAATGACATCTGTCCATCAGTGTGGAGAAGAGTGAGTGGGGTATGTCTCGAGTCGACTACCTGGGCCACAAGGTCT
CTGAAGCCAGAATTGaagcgaagccgaagaaCCTGGAATCGCTCGCGACGTTGGAGTTCCCGCACACGCTCAAGGGTCCTAGGTAGCCTGAACTACTACC
ACCCGTTCATCGCAGACTTTGCGATCTACGCGACGGCACTGTACTCCCTCACAGAGGCCGACTTCGGAGAGTACGCCACCCGACCGGAAGTTCACAGCCA
GGAGAAATGGATACACGCTCTACGTGCcttcgagacgctgaaggccaaggtcGCCAAGACGCCGATGCTAAAGCACTACGATCCAGACCGGGAACCGGTG
GTCATCGTGTACGCCAGCGACTGGGCGATCTCCGCGGTACTCGCGCAGGTATACAACGGTGTGTGTATGCCAGTGAAGTTCACTAGCCGCACACTCGAGC
CCAACGAGCTGAACTGTGACGTCGCCGAAAAGGAGATCCTGGCTCTGTTGCGCGTCTTGAACGATTGTTTCACGATGTTGGCCGGAAGGGCGATCCCGGT
CCTGACACGGCATACGACGTTGGCGTGACTTGTCCGATCTAAAGAACTGCAAGGCCGACTGTCGCAGTGGACTGCGATACTCGCACCGTGGAGACTGGAG
ATATTCCGGTCCATgaaaggagaagaagagatCCTGGGAACGCTAGCCGCGAGTATCACGCCCAGAGCGTTCGTAGATAtggcgctggaagagatCGCTC
CACGTAGACGTTCATCGCGGATCACTGTCATCCCGATCCCGACGGTGTCAtcggacgaagagctgcatgtcgtcagcttcgacggATCGGCCAGGGCCAA
GCGCGAAGGCGGATCGTTCAGCGCGATTGTCTGGAAACTGCCGGGCTGGGAGATAGTCCAGGCTGCGTCGGGCTACGCGTCCGACCTCACTGTCAACGAG
GCGGAGTACCGAGGATTACTTCTGGGGTGTTCACTGCTTGAAGGACTAGAGGTCACACGACTGGTCGTCTGTGGAGACTCGAATCTCGTCATCCGACAGA
TGCGTGAAGAGATGGACTGTAAGTCACCTGGCCTGAAGTTGTTGCGACAGCGAGGTCGGAACGCGTTACAGGCGTGGCCACGCCATGAACTCTTCCACGT
GCGCCGAGACTGGAACGCGAGTGCGGATATGCtcgctggacaagcactACAGCGTCAGAGTGGAGTGACTGTTCGCGGCCTGGATGAGATCCAAGACCTT
AAAACGCTGAATCGCCTGGGAGAAATCATCCGACCGGAACTTGGAACGTCAGATCTCTCGCCTTAGCCGGAAGATCAGGCTGACGCAGAACGCAGAACGG
TGCTGATATTACCTgtggccacgcgctccaccgcTGCTCGTGCCTCGACGCCAAGAGATCGAGAGCCAGAGGCTCTACGAGAGCTCATTGTACAGCAACT
CCGACTAGACTGCGTTTGCGTCGCACAGGACGAGAAACTGTGGATCGCGAACCTAAACCGATACTTGAGGGGCGACCTCGACGAACTCTCACGACGCGAA
gcgaagaactgcagcaagatCGCCCACCAGTACGAAGAGGGCGAGAGCGGGCTGCTCTACTATCGCGCGAAAGGTGACGAACCAGCGAAGATCGCGACAC
GATCCTAAAGCTTGTCATGCCAGAGACGATGTGTTGCACCACTACCAAGCGAGCTTGGAGGGCGGACATCAAGGCATTGGCTGGACGTATCAGCGGCTGC
GACGCCACTTCCACTGGCTGGGCATCTTCCGAAGCGTACAGCGCTACGTGGGAGAGTGCACGGACTGCGAAACTGGGAAGGGTCGACCGACGATCCAAGG
CAAGTCGCCGGGGAACATCGTCGCGATCTACCCGTTCCAAGTCCTGGCGATGGACCACATTCCATCCTTGCCCGCGTCGTACAAGGGCAACActgagctg
ctcgtctgGGTGGATTTGT