Description :
From Genome Similarity Track
Location :
Scaffold_181:1760- 3154
Transcript NameFunction/comments
Phyin_T30-4PITG_20581Putative uncharacterized protein

Sequence
1394 bases(100 bases per row)
AAGGCTGGTGCTGGTGGCTACGGCGCTACGGGCGTGGATCTCAACGCAAATGCTGGTCTCGGTGCACTTGGTTACGGCAATGCCAACGCCGGCACCGGTC
TCGATGCTCGTGCCGGCATCAACGCGAACGCAGGCCTCAAGGCGAATGCTGGACTTCAGGCTGGTGCTGGTCTCAATACCGGAGCGGGTCTTGACGCCAA
TGCAGGTTTGAAAGCGAACGCCGGACTCAACGCAGGTGCTGGACTTAATGCTGGTGCCGGTCTCAATGCTGGCGCCGGCCTCAGCGCTGGTGCTGGACTC
AATGCTGGTGCCGGTCTAAAGGCTGGCGCCGGCCTCAATGCTGGTGCCGGTCTCAACGTTGGTGCTGGCCTCAGCGCTGGTGCGGGTCTTAACGCCAATG
CAGGATTGAAAGCGAACGCCGGACTCAGCGCTGGTGCCGGACTCAACGCTGGTGCCGGCCTCAATGCTGGTGCCGGTCTCAACGTTGGTGCTGGCCTCAG
CGCTGGTGTGGGTCTTAACGCCAATGCAGGATTGAAAGCGAACGCCGGAGTCAACGCTGGTGCCGGACTCAACGCTGGTGCCGGACTCAACGCTGGTGCC
GGCCTCAATGCTGGTGCCGGTCTCAACGTTGGTGCTGGCCTCAGCGCTGGTGTGGGTCTTAACGCCAATGCAGGATTGAAAGCGAGCGCCGGACTCAACG
CTGGTGCCGGCCTCAATGCTGGTGCCGGTCTCAAGGTTGGTGCTGGTCTCAACGCTGGTGCCGGTCTCAACGTTGGTGCTGGCCTCAGCGCCGGTGCGGG
TCTTAACGCCAATGCAGGATTGAAAGCAAATGCCAGACTCAACGCTGGTGCCGGTCTCAAGGTTGGTGCCGGATTCAACGTTGGTGCTGGCCTCACCGCA
GGTACGGGTCTTAACGCCAATGCAGGATTGAAAGCGAACAACGCTGGTGCCGGACTCAACGCTGGTGCCGGCCTCAATGCTGGTGCCGGTCTCAACGTTG
GTGCTGGCCTCAATACCGGTGCGAGGTTTAACGCCAATGCAGGATTGAAAGCAAATGACGGACTCAACGCTGGTGCCGGTCTCAAGGTTGGTGCTGGTCT
CATTGCTGGTGCCGGACTCAACGCTGGTCCCTGCCTCAACGCTAATGCCGGCCTCAGTGCTGGTGCCGGTCTCAACGCTGGTGCTAGTTTGAATACTGGT
GCCGGCACAAGTGTGAAGAAGGGCACCAACACGGACAGCTACTCGAAGGGGACGAGTGCCATCGCTTCGTTAGCCCCAGAGAAGACAGCTAACCAAGCTT
CTCAGATGGCTACTCAGACGTCCACGAAGCCCAGCACTTACCGCCACCTGCGCGCTTAAACTAGGAATGATGGTCATCCTTTCCAAGTCAGAAG