Description :
From Genome Similarity Track
Location :
Scaffold_410:176- 11913
Transcript NameFunction/comments
Phyta_totarag8030hypothetical protein
Phyta_totarag8031hypothetical protein PHYSODRAFT_309064
Phyta_totarag8032hypothetical protein PHYSODRAFT_468056
Phyta_totarag8033hypothetical protein PHYSODRAFT_554409
Phyta_totarag8034conserved hypothetical protein
Phyta_totarag8035DEAD/DEAH box RNA helicase, putative
Phyta_totarag8036U4/U6 small nuclear ribonucleoprotein Prp31

Sequence
11737 bases(100 bases per row)
AACGGATGAGAAATAACCTTGCAAGAGTTTTGTCAGCAGCTGTGTGGAATACTAAGCGTAGTAGTGTACTGTACGTACTTGTATTTAATACATGCAACCa
ccaatgcagcagtgtagcAATGAAGCCAGATTGTACCGTCACAATGGTACATCTTCGgctagtgattcctccagatagtaataaaTGGTGGCTTCCACTA
CagagaggattgtctgtacctATTTTTTAACGGGGTTCCGAAGGTGACCGACTCGGTCCGGCTCCTGGGAAGACAAGATTCATTTGTCATTCAATGCAAG
GTGGTGAATCTCCCCAATCTCGGTTTCCGACGGGATAATTGAGCTTGCACCATCCAGCCGGAATGCCCAATTTCAGtaatacagacaatcctctccgctg
tgatatcccaaatagtgATACCCTCTGGTTAACGCGAGCTGAGGCCTCTCCTGACGACCCATGTCAAACAAATCCAAGTCAAAACTACCTCTAACCTACA
GATAGTGCTTAGTGATACGAAGTGGTGGTTATTACTATATATAGATCATTAAATATGGGGGTTGTATGTTTGGTAAACCATGttcagcaacgacatttgc
tgcttaCGGTATCGCTTGCGGCTCAACTCCTCTCGAAACTCGCTCTGAATTGTTTGAAGCCCGCTCACTGCTCGAGACGGCACACCCACAGCGTAGGAAG
AGCTTGGCTTTCCACTGTAGTCGCTCTTCAGTTCTTCAGGGCTCAACTCTGCGGCAGTTAGTGCATCATAactcactgcatcacaaactccGTCGTTGTC
GTGACCAGGCTCGTCCTGCTCAgcctcggcgttgcagaagtcTTCGTCTGTGGGCTCGTCCACGATCGCGTTCTCTTCTGGCGGGNcagtgtagccatga
agtAAAATAGTACCGTCATAATGGTACAACTCCGGTTAGTGATTCCTCCATATAGTCATAAATGGTGGCTTCAcgaggctatcactacggagaggattga
CTGTTCAGACAACCCCTCTATAAGGATGGCGTAGAGTTTCTATCCTTATAGTTATTCTTATAGAAGGGTACTCACCTTTTGGTACACATGACCTCGATGG
CTTGCGTCGCTCATTTCCTTACGCTCAGGCAGGATACCGTCCACCTCCAGAACCTCGCTCTCGCAACTAATTCTCCAATGACTAGCGCAGCTTTGCCGTC
ACCACAAACTATACCCCGCTCTGActcaggaagagcttgacaAGAGGGCTCAGACGACGTTGAAACTTGTTGAGCGTCCTGGTCAAGTGACAATCACCAA
GATCCTCAAGACCAGTAAGAAGTTTGATGCCACTCCGCTGGTGAAACTGGAGTCGAAAAAAGAGCGTCAAGTCCGTTTTCCGCGACGTGCGCTCGATGGT
GTGCCAGCTGAGCCTGAAAGAACCGATGGCTTTTGAAGACCTGTTGAACCCATACGAGGAAAACATCGTCACGGAGAAGCCTACCGACGAGGACGTTTGC
AACGTGGGCAACGACTcgaacgacgaagacgaggtcACATCCGGTCGAAGCTTCacccgtggagatgacggcggcAGAGTGGATCCCCAATACATTAGCT
ATTTTATTGCCCGATGTGATGAAAAGGGCCTTCCAATGGGCGCATTACGCGGCCTCCGCATTCTTCAGCGTGGATATCGCGAGGGGTTTAGCCAGAAGCA
GGGTCCAAGGCAGCAAATGTCTCCGGACCTACTTTAGGTCTGCATGCTCGTAGACTTACTTTACAAATAGAACgtttcccatagttaagcacctctCTAA
AGGATATCTGGCATTCTCTATTCTTATATGATTATAGCGGGGGAGAGGGAGTTTTGTATGGGGTTTGTGCGAAGTGGTCCCAACTTTATTCTTATAAAGC
GACCATCCCTATAGAGCGGGAATATAGGGGTTGAATGctcatttttttaaatggGTAGTTTAACTGAAAAGGTTCCCAATTTCTCACGCAAGAAATCTCG
CGCACCGTACCCCTACCCACGACAAGATTCGCTTGATGAAATCATGTATACAATCTCAAATGACTTGGGATCAGCCAAATCTAGATTcaaaaaaagaaaa
actATAGGGATTCAGTATGCCCCCGGCAAGAAACGCGCTCGCAGTCGAACTGCCAGTCTCACTTTCGATTCCGCAGTGCCGAGCACAAGCATATATTTGT
AAATGAACGTTAAAGACCTTCTGACCTGCGAGGCAGCGCCTGTATGCCCGGCGTCGCCCGCGATGCCGGTTCacagctgctccagcactaGCAGTGACTC
TAGCTCTAGCTCGAACGAAGCGAAGCGCGGCTGGGTTGCcccgttcctgctgcacctgcaccagaTGCTGCGACGCGAGGACCCCAAGATCATCCGCTGG
GCCGAGGACGGCATGGCCTTCCAGATCCTGGACAAAGAGGCCATGACCTCTCAGATCCTGCccaagtacttcaagaacaagaacttctccagcttccagc
gccagctcaaCTACTTCGGCTTCCGCAAATGGAGCAAGGCCCGCGCGCAGTTCCCCACCTACAGCCGCGAACACTTCACGCGCGACAACTACAGCGAGAT
GTCGCTGGTCAAGCGCCAGAGCAAAAAGTCTCGCAAGCGTAAAGCCGCCTCTGACGAGGAGCAGCCCGCCAAGCGCGCGGCCGTGCCGCCGACCAACTGG
GCAGTCGGTGAGAAGTGCAAGCCCATTCTCCCACGCCCGGGCGCTATCCAGGAGGCTGCTGTGGCCGCTCCGGCGCAGTACCAGCCTCGTGTCATGTCTC
CGCCGATGCATCCAGCGCCCATGTTCAGCCTCCCCGTGCTGTCCTCCGCCCGCAAGGTGAACAGCGGCTACAAACTGCCGTCCATCCGCGAGATGCCGCT
GTCGAACGCCATGCCGTACGCGGCCATCGGCCCCATCCGTCCCCGCCTCATGGCGTAAgtgtccgtcgtcgtccgaatTTTATGGTAGTCAACTCGAACA
ACAATATTTATACAAGCACTCAACTTTCAACCTTCATCCAACTTACTCTCGTAAGCGGTACCgctattttaatattaaaataacATAAAAGTACGATAAA
TTTCGAAAACCGACCGTTGAAAAGGTCAACGTTCCAGATTATCTTTCTTCCGATCCAAACTTTGGGCAGTATTCGTCCAATTCCATCGTACTCACGTTGC
CAAGTTCTCATGCCgagcctgcagctgcttctgcttctgctcgcgGGTGCCTTGCTGCCGCTGACGAGAGCTTGCACGATGATCGCGGTGGGGCGCAACG
TGACGGTTGACGGCTCTACGCTGGTGGCTCACACGGACGACGCGGGTTTCGGCGCTGCCGACCTGCGGATGGTGCGTGTACCAGCTCAGGACCACGCGGA
AGGAGCAATGCGGCACGTGTACAACGTACAACCGGGTTACCCACGACTCGTGACGACCGAGAGAGGACCCGAGTACGAGCCAAAGAACGACCAAGAGCAG
CTCATGACGCCACTCGGTGAGATCCCGCAGGTGCCGCACACGTACGGCTACTTCGACCAGGATTACGGCTTCATGAACGAGGTGCAGCTCAGCATCGGAG
AGAGCACAAGCGGAGCTAGGACGGCGGGCTGGCCCACGGACGCGGGTCCGCACGGATACAACATGTTCGGTATCGGAGAGCTCACCAAAGTGGCACTGGA
GCGCTGCGACTCGGCTCGTTGTGCTATACAGACCATGGGCGACTTGGCTGTCAAGCACGGGTTCTTCAGTGAAGACAGTGGCGACCCGGCCAATCCAGAC
TTCGTGAGCGCAGCGGAGACGTTAGGTATTGCTGATCGTTACGGAGAAGTGTGGGTCTTCCACGTGCTGACAGGTCCGCAGAACGCTAGTGCTGTGTGGG
CTGCACAACGCGTGCTTGATACGCacgtggtcgtggtggccaATGGCTTCGTGATACGTGAGATGGATCTGGACGATCCAGACCGCTCCATGGCGTCGGA
GAATGTGCTTTCATTTGCTGAAGAGATGGGGTGGTGGGAGCCGAAGCAAGACAAGTTCGATTTCACTGCTGCATACgcttctccaacgccagATCCCGTG
CGCGCGTTGTACATGGGCCGTCGCATATGGCGCGTGTTTGATCTGGTGGCGCCGTCCTTGCAGCTGGACCCCCGCCTTGGGCACTACCCGGAGTTTCCGA
CGTACCCGTTTTCAGTCGAACCGGACCGGAACCTTGATGTATCGGACGTGACACGCTTGCTGAGGGACTACTTTCAAGGCACGCCTTATGACTTGTCCAA
GGGTCTTGGTGCGGGACCGTTTGGGATGCCGATGCGGTGGGGAGGCGACGAAAAGGGCGTCGTAGGTGGCTGGGAACGACCGATTTCTATGTATCGCACC
GTGTTCAGTTTTGTGCTGCAGGCGCGTGCCCACCTCCCTGATGCGGTAGGCGGTGTTGCCTGGTATGGACAGAGCTCGCCGCATGCATCGGTGTTCGTGC
CATTCTCCTGTGCACAGCAAGAGGTGCCGTCTGCATACGTCCTCGGCAAGGAAAGCGAGTTTACACTTGGTTCAGCCTGGTGGGCATTCAGCTTCGTTAA
CAACTGGAGCATGATACGCTTTGACGCCATCAGCAGGGATATTCGCGCTCGAATTGCTGGGTTGCAGAAGGCTTGCTTTGTTGAACGGAAGGCGATGGAA
CAGCACGTCGCTCACACCGAGTCCTTAACAGCATCCGAAGCGCGCATTTACCTGCAGGAGCAGTCTAATCGATTGGCTTCCCGAGTCGTCGAAGAATGGT
GGATATTTGCATGGAAGCTTGTGGGCAAATTCACGGACGGCTACATCACCACTGGTGAAGCTCCAGCGGAAATGGAGATGCCTGGTTACCCGGAATGGTG
GCTCAAGCTCAGCGAGTTCTCCAAGTGGCCAGGCGACACGCTGGTGCCCCCACACGTCCcagcgctggagaagcagctcgagctgtTTCAAAGTCGCCAA
AATGCGAGCGCCAATCTTGTGGTGCAGCAGTCTGCAGGCGGTGACAGTGCAACGTCTTCAAACACTGTTTCAATCGCTCAGCTTGGCATCGGTGCTGTAA
TTGGGGCCGTTGTAGGTGCATCTGCTACGTGGTTTGTTGCTGAGCGACAACGTCGATCTGAGTATCGGTCCATCGGCTAAGCGCACAACGAGTGGGTGCA
AAGAGGAGATTGCGTGTTTTTCGTATAGGTGTTGGTCCTGGTAGAGCGCGAATACCCAGTAACGGGCGGTGAAGGTGCAGACAGATTATGAGTTGCGCTC
GCTTACCTGGTATTCTTCAATCGCACACCGCTTACCTATCATGGAGTTGTGGCCCTCTAGTATCTCTTGTGCGGCTCCTTGTAGTTTCGCTTGGTCGCCG
GGCTCACAGAACGCTTGCGTCCGTGGCTGCGCCCTTCATGTCCGCTGCTCGGTGAGGTGCTTCggctgctgcggttgctcTTGAAGTGCTGCTCACTACG
AGAAGGCTTGGTATCGTTACTGCTGAACGTTCTCCACGAACTACCCCCACGCTTTTCGTTGCCCTCACGACTATCCCTCTTCTTTCGGCCGTGAATCGAT
CGATACCCACCCCGATCTTCGCTGGTAAATCTCTCCAGCTCTCCCCCTGGACCTTTGGACTTGAATCCTCCAGCCCTGGCCGCTTTGGGAGCAGCAGTAA
GGCCTGGAGTGTCCATTAACCCCATCGCTCGCAATGTTTTTttctgcagcatcggcaCCTTTTCCAGTCCAATGAACTGGCTGTAGAGTGCGCCCGTCTC
GACAAGCTTCGTTTTGGACATGCGTAGCTTCTTGAGATTCGAGTTGTAGAACCCCAGGAAAGCAGCATAAGCCTTCTCTGCCGATTGCTCCAGCTCACTG
CGGGGACGAACGCTTGCGAGGGCACGTGTGGTTCGGTAGTTCTGCTGGTCGAGCTGAgggcgctgctcaagttctgTAAGTGGCAGGTCGGCCAGATCAC
GAAGCATCGCCTTCTCGAAGTCGGCCAACACCAGAATGCCACGTCCCTCCATACCCGCACGGGCAGTTCGTCCTAGGCGGTGGATATACTGGTCACGATC
CGTGAGACCCACTTGCAGGACCAGCGACACATCTGGGTAGTCGACGCCACGCGCCGACACGTCGGACGAGAACATGATCATCTTCTTACCCTTGCGAAAG
GCGTCGGCGGCCTTGGTACGTGCAGATTGACTCTTGCGCGAATGCATCTCCAAAACGTTAGGGAAACCCGCAGCCTGGAAAAGCTGCGCCATGAACTGCG
CGGACCGTGCAGTAggcaagaagacgatgacttTGTATGCCGGCAGCTTCATGTGCTCTTCCAACACGCCTTCAACCACGGGAATGACATCTTGCAGGTC
GCACACAACATACTCCTGAACAGCCTGCGTGTTGGTCTGTTGGTCGTCACCCTCAACCGTATCCACAAATGCGTAGTCGTCCCGCAGTGCCAcatccttg
agctgctcggtCGCAGTCGGCAGCGTCGCactgaagagcagcgtcTGTCGCTCATTTGGCAAATGGCTGATTATCCGCATGATATCGGGGCGGAATCCCA
TGTCCAGCAGGCGATcggcctcatccagcaccagcacctgcagattctccagcttctgtcTGATGCGTCCACTGTTGTCCTCCAGATGCGCTTGCAGACG
TCCTGGGGTGGCCACCAGCACATCAATGCCTCTCGGTTGCGtcagctccttcacgtcCTTGTTCACCGAGCTGCCGCCCACAAAGACGGACGTGCGTAGC
GCATGGGCGTCCGTGAGCTTCACAGCTTCCACTGCGATCTGCTGTGCCAACTCTCGAGTCGGAGAGATGACAAGAGCCGAGATGTTTCCCTGCTTGGGCT
GCGGGTTCTTGAGCATCCGCTCCAGTGTCGGCAACAAGAAGGCGATGGTCTTCCCATTGCCCGTCTTGcccttggccagcacgtcgcGTCCTTCCAGCAC
GAGCGGCAAAGTGTCCTTCTGCACGTGTGTCAAGAACTCGTAGCCCATGTCGCGCGTCAACACATCCTTGGACTGCTGGCTGATTGGCAGAGAGGCGAAC
GAAACGTCCGACAGATACCCACTAGATGCACATGGGATGAAGCTCGAGTGGAAGCCACGCGCACGCAACAAGcgcgacgactgcagcagcgtcgacgatA
GGTGGCGGGCAGTCCACATTGCCGATTGGTAGGTCACCGAAGCAGCGACCCAAAATACTTTCTTTTGGGTATCTCGAAATATGTCGTTTTGGGAAGAGTA
GTATTTTGGGTCGCGGTTGAGATTGGCTAAAAAAAAGCAAACCGTAGTACGTAGACGTGGCTCGAACCTAATTTGGTCTCTCTCATAATCCGATTGACGA
CAACCTGCACACCTGACACGGGAACTTTGACGATGGCGCTCGGTCgactgctgcgtgtgctggcGGCATCTCTCgctgtgctggtggcggtTCCTGCGCC
CTCAGATGCCATGATCGTGGAGCTTGACGGCCGCGTGGAGGAGTGTTTCCACGAGTACGTGCGCACTAAGCGCACCGCCTTCATGAAGATCGGCGTACTG
GACTCTCTGGGCGCCTACGACGTGCGACTGAAGGCGTTCGGCCCGTTCCCCTCGTACCCGGAGCAGGATCAGGTGGacaagaacttcttcgaccagttgg
tggtgacgcCGCACGACGAACAGAACCAGAACATCGAGCAcagcggcttcaacttccagTCGGAGCACCGCGGCGGATGGTACCGCTTCTGCCTGAACAA
CGCGcacgacggcaagaagaagtcggtCGAGTGGTACACGTCCTTTGACCTGTCGAACGAGGAAGATCTGGGCGAGGAGGACAAGCTGGAAGATCAGACG
CGCCAAGGTGCGTTGGGGTGACATTGGAGAAGTTTGGGGGCACGGACTGACGTACTTGTGTGTGTGACTTTGCGTGATGGTGGCAACAGAGCACGTGGAA
GGCGTGAAGACGTCGCTCGACCGGTTGCAGAcactgctgaagctgatTCGCAATGAGCAGGACTACTACCGCGCGCGAGTACACCGCCACGTTCAGAGTA
AGCTTCACGTTGGCGGATTTTTATTGCTGCGTGCACTAACTAACGGTCGGTCAATTATTGctttttgtgtgtttgtAGCTCTTTATAGCAGCGAGTCCCG
TATCATCTTTTACACCGTATTTGAGCTGGCCGTGTTGGGTGCCATGTACGGCGCGCAGTCCTTCCTGCTGCACAAGTGGTTCAGCGATCGCGGCTATCTC
TCCAAGCGCCAGTGGGCATAAACTGCATGACGAAAGCGCGGCATAGATAATAATGCTGCGTGCACTAACGTTGCTGTCTTTGCAGCTGACGGGGGTGAGG
AAGTGTCTACAAGCTTAGCGAAGAACCATCGAAAGAAGTGGCGATAGAGATTCCCCAACACCGaaatacttcaaagtactTTTTTGTACCACACCTTGCA
TTATTGACCCCTTGGCATGCATCCTAGCATGGTTCTCCCGTTGCTGAAGTGAATGGTCGGTTAATAATCCGAATCATCGCtctcgatctccatctcgtca
aTTATCTGTTCGCATCGACGTTGACGTTCCTCAGAGGTACCAgcacttcctgcagcagacacTGTAACTTGGTAAACGGGGTCCCCTACGCCACCCTCCT
TCACGGAGAGATAAAACACAGTATCGTTGTTTAGCTGCGCAGCTGGAACGAAACGGTACCTTCCCTGTTCGTTTGTCAAGATGCCTTGGATCGGACTgag
atcgaggagctccCTCACTCGTGTCAACAGGAATCTGTCCGACGCCACCGCCACTTCAGACGGACCAGGAGAAGCCCCTTCCTCTCCAGTCTGCATAGCT
TGGAAGCTTCCTTGTTGTAAGTAAAACACCCGGAACGAAGAGCGTTTGGTGAGTGTCTGCTGCGTGCCAGGACTGTTGCATTCCAGCTCGATGAAGCCCG
CGACGGGaccgacgacgtcatgtATCGTCGTTTGCAGCTGCACTCGCTCCCCGGCACCAAGCGACTCGAGCGTCGTAGAGAAGAAACTTGTCACAGAATT
GTACAGTTGTGCGCTGATCTTCGTCTGCCCCAACATGATCTGCGAGCGGTTCTCCACCGCAATGAGCAGGCCCCCATTGACGTTGTAGCCGGAGGATATG
AGCAGGTTCTGCAGCATGGCCGACTCCATCACTTCGTTCATCATACGCATCACCTGCGCGCTCTGCGATAGACTCTGCCCCACGCGCTCGAAGACCGACT
CGAACGACTGCTGCAGGCCGCCCGCGTAGCTCTCTAACATCTTAGccatctcgtccatcgtTTCAAAATGTTGGGTACAAAACATTTTGTAGCCATGTCC
ATAAATGTAGGTTTTACAAAAATAAAACTACATTTATGGATATGGCCACACGTTGAACTTTACggttaccggtattaatacatgcatGCTGATCTCGTAA
AGTTCATGAGAGTATATTTTAGTCACTCGACTCATCCTTCGTTGCAATAAATTACGATTGGGTTCTAATGATGAGGAAGTCACCTGGTGTTCTACTACGA
AATCCAGTCGCCGAGACGCAGATATGGATTTGGTCCTTGGTCCCAGTCTCGGCGCAACGACCTTGATGACTTATCTGCGGCCGTAGCCACCACGGTTACC
ACCACCGCGGCCACCGTTGTAGTTGCCGCTGTTGTCGCGGGTGTACGGCGACGGCTCGATGCCAGGCACGCCGAAAAGgttcatcttcttgagaGTCCTC
TTCTCGAGTTTAGGCACCTCGTCCAAACCGATAATGCGGCTGTAGTCGGCCGCAAGCTTCACGAGTTCCACGGGCTTCAATTTCAGGCGCTTGGAGTGCG
AATTGTAGAAACCAAGCCACGCCTGGTACGACTGCTGCGCCGACTTCTCCACATCGCTGTAGTTCTTCAGATTCTTCATGACCTTCAACGTGCGCGACTG
CGACGGCACCAGCATCTCAGGCgtgtgcttcttgctcggTTCCAGAGGCAGATCCGacagcttgtccagcagaTGCGTCTCAAACTCGGACAGAACAAGA
ACACCCTTGCCCTTCATACCAGCACGTGCCGTACGTCCAAGACGGTGGATATACTGATCGCGATCGGTGAGGCccacctgcagcacaagcGATACGTCTG
GGTAGTCCACTCCACGCGCCGACACGTCGGAAGAGAACATCATAACCTTGTGGCCCTTACGGAAAGCCTCAGCCGTCTTCGTGCGCACTGCCTGGCTCTT
ACGCGAGTGAATCTCTAGGACACCCGGGAAGCCCGCGGcctggaagagctgcgccaTGAACTGCGCCGAACGAGCCGTCGGGAAGAACAGCATTACCTTG
TACGCCGGCAGCTTCATGTGCTCAGTCAGCACACCCTCCACCATCGGGATCACATCCTCCATTTTGCATACAATGTACTCTTGCTCGGTCTGCACATTCG
TGTCGGCCTCGTTCTCATCAATCGTGTCCACAAACGAGTAATCCTTCCGCAGAGcgacctgcttcagctcctccgtGGAGGCTGGCAGCGTGGCGctgaa
cagcagcgtctgacGCTCCTTCGGCAGGTATCCGATGATGCGCATGACATCCGGGCGGAACCCCATGTCCAGCAGTCGGTCGGCTTCGTCCAGAATCAAG
ACACTGGCCTTGCCCAGACGGTCAGCAATCCTGCCGGTATTCTGCTTCAAGTGGTCGACCAGACGTCCAGGCGTGGCAACCAGGATGTCAACCGGCGCGC
TGCCCGTGAGCGTGcgctcgtccttcttgatgttCGCACCACCCACGAAGCAGGCGACGTTGACGTCGTGGAACTTGGTGAGACGCTTAGCCTCCGTAGC
gatctgcagcgccaactcACGCGTCGGCGAGATGGCAAGAGTCGGGATGACGCCCGAACGGCGCCCCTCCTTTACCATGTTCTCGATCACTGGCAGCAGG
AAGGCGATGGTCTTGCCGTTTCccgtcttcgccttcgccaGCACGTCTTTACCCTCCAGGATGAGCGGGAACGTCTCGTTCTGCACGTTGGTGAGGCGCT
CGTACTTGAGGTCCTCCACGATGGCGCGCTTCGTCTTGGCCGAGATGTCCAGCGACGCGAACAGGACGTCCGACAGATAGTCCATGTTCGTGGGCTTGGG
AGCCTCAGCAGGAGCGGCAGCCTCCTGGTTCACCGAGGGGGCAGCGACGGGTGCAGGCGCCATCTCCTTGGGCTGGTTGTTgccgttggcgttggcggcg
tctccgttcttgttgttgcgacggccgccacgacgcggcttcttcttcttgtgctcggcgtcgctgtccTTGCGTCCTCCGGCCGGCGTCTTGCGGcgcc
agttgctgctgctgttgttgctctcTTGGCCCGGCATGTTCTTCTTTCACTTGACTGACTTGGGTGCGTGCGTGGCAGGACGAGAATGCGGAACTGAAGC
TTCTCCCGTCTTCAGAATCTTCAGAAAGTTAAACGCTTTCCACCAACCGACACGGTGGCGTTTCGCAGACGAAAAACCACTTGACAATTGTATCCGACAT
ACAAAAACCGAGTTTAGGTTTTAGATTTCGCTCATTTTTCGAGGCCAAGCTAGGGTACTGAAGCCATGTCGACGCTTGCGGACTCGTTCCTGGAGGACTT
GGACGAGCTCAGTGggggcagcagcgacgaggacgag