Description :
From Genome Similarity Track
Location :
Scaffold_7:1759766- 1760872
Sequence
1106 bases(100 bases per row)
GAGGCAAGTAAAAAGCGGCAAAGAGGCCCCACAACAAGCTCCGACGAGTCCAACAACAAGAAGCGCGGGACCGGAATTGAACCAGTGACCCTTCGAGCTG
CAATCGAACGCTCTACCACTGAGCTACCCGCGCGTCGATACCATACCCACCCTTGCAAAACTCAAAAAAACAAACGCGCACACACCTTACAAAACCGAAA
CGGCCACGTACCCATGCACACACTCTCCGCCGACATCATGCACACCTCCAGACAGTTTACTTTCTATTAACCCAACATGCCACATGCGTTAACTATGACA
CAACTCCACCCCTTTGCGAGTCGCGATTTCACTTCTCCTAATTCGGGACTAGAGATAACAGGAGCTAACCGGCGCGTGCGAAACCATACCTAACCCCCCT
GGCCCAACTAAAAAAAACAAAACACGCGACACACACCTCACAAACCGAACGGCCACGTACGCACGCACACACTCTCCACCGACATCATGCACACCTCCAT
ACAAATTGTTTTCTAGTACGCAGCGTGAACATCGTACCATGCACACTCACCCCTTCGAGTCCGATTCACTTCTCCTACTCCGACGAGCGATACAGACAAG
CACATGGATGGCAGATGGACGGACGTCCAAGCGATTGAGCACCTTGACCGCATCGCAACGCAGTCGCGACGCCAACAAAGTCAACGCTGACCGCTGGATC
GACTGTCTGAGATTCCCCAAGGAGCCAACAAAGGCTACATCGAAAAGAAGATAGCCGTGTTCCAAACAAGCAGTATATCCGTTGCTAGCGTTGGGAAGCG
TCTGCGCGATGGAAGCTGTAGAGTTCGCGAAAAACGGAGGCAAGTAAAAAGCGGCAAAGAGGCCCCACAACAAGCTCCGACGAGTCCAACAACAAGAAGC
GCGGGACCGGAATTGAACCAGTGACCCTTCGAGCTGCAATCGAACGCTCTACCACTGAGCTACCCGCGCGTCGAACCATACCTACCCCCTTGCCCAATTC
ACAAAACAAACGCGCACACACCTCACAAACCGAACGGCCACGTACGCACGCACACACTCTCTACCGACATCATGCACAACCCCAGACAGTTTACTTTCTA
TTACCC