Description :
From Genome Similarity Track
Location :
Scaffold_1:17593- 22862
Sequence
5269 bases(100 bases per row)
TCACCGGAAGAAGTCCCGTACTGGTGATAAGACTTAAGGCGACCGACGTAGAACGTAGGATGCATGCGCAACTTACGTGGCATTTCAATCGTGTATGCGT
TGCCTAAGCGGCGCAGCACACGAAATGGACCGATGAACTTAGGTAGTAACTTGTTACTACCCACGTTAGTCACTATGTGTTGAGGTAAGTTTACCGTAGA
TAGTAGGACTAGGTCACCTTCAGTGAATGGAAAAACATTTGCCCTTCCATTTTTGTCTGCGTTTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAATCT
TGCACGAAACGGACAACCGTTTTGCGAGCCAGTATGAATTCATCTGCTGACTCGCTTTCTTTGACTATAGTGCGCTTGGAGCGCACTGTGGCAAGATCAG
TGACCTGGGTAGTTAGAGCATCCTCGCTCTTACTTTCCTCTTCTTCACCGAAGTCGATGTGATCGATATCGGCGTCATACGTAGTGACCTCGTGGTCAGT
ACGTGATGAGTGAGAGCCGAGTTGGCGTTCACTCGAACGATTCTCCCCCCCCCCTCAAACTATAGTTACACTCTAAGAAGGTGGGTAGGCGTGGGTGGCG
CAAGCCATTGACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAATTCCACAATTGGCAATAATTCGCTCCAATTCGTAAAC
GAATGGACATAACCCCGAACGATTTCCTTAAGAACGCGGTTTGCACACTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGCG
TACCGAGTGTTTCGAACGCGGATCGCCAGAATTCTGCAATGAACCGTGGGTCTTGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGATAGATCGT
GTCGATAAAGACACGGGCACAAGCCGATGCGTTGATTGATTCGGGTACAGCAACCAGATGTATCATTTTACTGAATCTATCAACGTACACAAGAATACCT
GTATTCTTGTGTGGGTGTGCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGTGTCGGGTTACGCATCCGGTTCGAAATC
AGGCAGAGCATCAGCGACGACATTCAGTCTTCCTGGCTTATATTCCACGGAGAAATTATACTCCGCGAAGAACGACAGCCACCTCGCCATTTGCTGCGAG
AGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGCATGGTCCGTGTAAACGATGAAGGTTCTACCACCTAGCAGGTAGACTCTGAATTTCGGCAAAGCGT
ACTTCATGGCAAGGATTTCCTTGTCATGGAATGGGTAGTTACGTTCAGCCGGTTGCAGCTGACGTGACTGATAGCAGACGACACGCTCAGCACCGTCTGT
GTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGCCAAAACTGGCGAGCGT
ATCAAGCAAATCTTGATACCTTCGAAGGAGCGCTGGCAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAGAGATGACCAGTCATCT
CGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAGGCCAAGGAAATTTCGAAGTCCTTTTATGTCGGTAGACACCGGCCAGTCAGTGATCACCTT
GATCTTTTCCGGATCGAACCGGACGCCATGGTTACCCACGATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATGCACCACTTGAGGTTGGCGTAC
AACTTATGCTCAAGCATCAGTGTAAGAAACTTCCGGTCGTGGAGTCGGTGAACTTCCAATTCCGTCTGTCCATCCATAGCCCGGCTATGAAAGAACACAT
CATCGAAATAGCTAGGTGCGAATTCTTGCACATATATCAACAGATTCGTAACACATCTATTGAACGTATCAGGGGCATTACTCAGCCCTTGTGGCATTAC
CAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGCTGTGTAAGGAATGTCCTTTTCACTCATAAGGATCTGATAGAACCCGTCCATCAGATCCATC
GATGAAAAGATGGTACTCCTTGCCATACCATCTATAATGACATCCTTTCTTGGTATCGGTGTTTGAGCCGGTACAGTTGCAGCATTCAACTTGTTGAAAG
CATGTACTATCCGCCATCCTCCTGTGACCTTTCGGACACAGAAGGTCGGAGAGCTATGAGGGGAAGTAGATTCCCTCACATGACTCGCTGCCAACCGATC
GGCGAAGAATTTGTCAATCGCTAGTACTTGTTCACGAAGCAGTGGCCATTGCTTCATGACACAATAATTTGAACCTGGTTTCAGGCCGATCTCATGACGA
GTACCCTTATCCTTAGGTAGCTTGCACGGCACTGTTCTGGGAACACATCTCTGAATTACGTCAAATCATCGTAGAGAGGATTTGTCTTGAGCGATTCCCA
CGATTGGGATGTATATCGATCAATCCGAGTCTTCTCATCGAGGACACTCTCGTCCATTGAAGAACTGCTGAGAACCCTTTCGTTCTCAGCAAATACCATT
GCCGACCGAATATCGATTACGTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTGCGCAGATCATGCATGAACCTCTTCTGTTTGA
GCGTTGGCAACTGAGTGATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATCAAGTGTATGACTACCTATTCTTGATCCGTCATTGACCAGGACATTTGA
TGTCTCTGTTATCTCCTGGGAACTTATTTTCACAGTTGGGTGGGGACTTATTCCCTCACTAGTCTCTTGGAATAAATCATCACATGACACGAGTGGAATT
GCTCCCTCGCTATCTTCTGGCGGTGGTTGCGCTACCACGGCCAGGTCTTCTACGTGCGATTCTCCAATCGCACTAAGATCATCGTATTGCCAATCATTGG
CAATCGGTTCGTTGTTACTTGGGTGTTAACCGTTTGAAGGACACCCATGCCCAAGAACACTCGACTTATTCGGGTGGTGGGCCTTCGGCGCGACCTGCAT
CTCAATGCAGTCGCCGGATTCTGGCTCCATGGTGTGGGGATTAGCCACGCCATGGCCATATGCAGTCGTATTAACGACCGAACCACACGCGAGGTCATCA
GATGGCCATCTGATGAACAACTTACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGGCTCGTACCTTCTGAGCCACGGCAGTCCAAGGATAAC
ATCGAATTTGTCATCCAAGTCCAATATGATGAAGTCATCATCGTATTGGACTCCCTTTAGTGTATAGGTAATACCCACTACACGTTTCAATACTGTCACG
GATGCGCCTGTTGCGAGGCGCACCGTCATCCTCGGTGGAGGGATCTCGCGCTCGATATATAGCTCGTGATTATCTAGCGATTGGCGTCGTACGAAGTCGT
TTGATGCTCCAAAATCGACTGGGGCTCGTAGTGGCATATTTCGTGTCACTTCGAGTTTCAAGGTAATGAGGGAAACCTCATTACCAGAAGCAGCAACACA
CAATGATTGAGTGTTGGGAGAAACTTTCGTCTAGAGGCCTGCAAAATCACTCGACGTTGCTGGATCAGTAGGGTGCTCCGCACCTACTGACCCTGACCAT
TTCTTGGCTGTCCGTTTCGTTGTTGCGTCTTCGCAACAACTACGGACCCACGCCTTGGACCTCTCTTGGCCGCTTGGCGGTTATTGTTTCCTGCGGTACG
TGGTACCGCGCTCGGGGCACTGCATTCGTATGCATAATGCCCTGTCTTCTGACATCTATTGCATTTTTGCAATTTCTTGTAATTGTTAACACGAGAGCTC
TCGCTCCCCGCGTGACAGAGGTCCATTGGTTCTGGGCCTTCATTTTCCTGTGTTCTCGATGGACGATAAGAATTCAAATTCGCGTGAGCCTGTATCACGC
TGAAGTCCTCCTGTTCCGCAACCCTTATCGCCTCTTCTAGGGTGTTGAATTCCAACCGGAACTGGTAGGTTTTAACAGGACCATCTGTCAGACCCTGCAT
GAACAACGTAATCAACTTTTGTTGATTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTACGTCACGTTTATCT
TGCTTAATTCTCAGGAGTTCAGAGCGAGCCCTGAACTCAGCTCGCGGCGGCTCAATAGTTTACCTAAGCAGAGACTTGAAGACTTCCAGCGACCAAAAGA
AATATGGGTCGTGTAACTTAAGGCCCAAGGCCCACGTCTTTGCACGCCCTGCCAAGTTCGATTGAGTAAATGCGATCTGCATTTCCTCATCGACGATATG
ACGAGCCCTGATGGCATCGTCTAGTTCCACGAATCATCTTAACAGGGAGTCTTCATCGGCTCCCTTGTA