Description :
From Genome Similarity Track
Location :
Scaffold_4:1758871- 1784815
Transcript NameFunction/comments
Phyin_T30-4PITG_03432Putative uncharacterized protein
Phyin_T30-4PITG_03433Regulator of chromosome condensation (RCC1)-like protein
Phyin_T30-4PITG_03434Putative uncharacterized protein
Phyin_T30-4PITG_03435Putative uncharacterized protein
Phyin_T30-4PITG_03436Putative uncharacterized protein

Sequence
25944 bases(100 bases per row)
CCACACAAGATCCAGATGTCGGGAAGAGTCGCTGCCGCTGGCAGCGGTTGCACCCGGTCGATTTTAGCTCACTGGTCGAGTTGAGCGGAGAAACCAACAG
TAGACACAGCAGACAAAACAGCTTTAGCACCTAAGCCGAGGCCATGGGGCAGCAGGTCTCACATCCGGCCGCGGTGACGCAGCCGCCGGGCGAACGCGCG
AAGCTGCGCCCTCTACAAGCGCCGTACGTGCCGCTCTGCGACGTCCTCAAGGCTGGTGACGTGGAAGACGTTAAAGACGCAATGGATAAGATCCTCGAGT
TCGGCGATGCGCTGCGCTACCTCCCAAGAGGTGATCGTTGAAAAGCACATTATTTTTAATTAGTTTATTGTCTCAATGTAATGTGTCTACTACCAACAGA
GAGTGAAGTATCCGGACGTCTGCTGACGCGCAGTCCGGAGCAACAGATGAAGGAGCTAATAAACCCCGTAGACTCCGTAGACGAGTTATTCCAGCATATC
TCCCAGCTGGCAGGGCTGCCGATGCACGACGGACGCGACCTAGCACGCCCTGACGCCAAACGGGACGCTGGCGAGACGATGCCTGGAGTGTTCGACGCCC
GCGTGGCCACCTACGTGAAGAACTTGCAGTCTGTATACCAGATGACCAAGAAAGAAAAACACCGTCACGAACAGCGACTTGTGGCTGCTAGAGCGCACGC
CATGTCACTGAGCAAAGTGTCGCCGCCGCCACTGCCAATACCGACGCAAACCTGTCTGACAATGGGCTGGGATCTGGTCGTGATGCTGCTTAAGGCTACG
CGTAAGAACAACCCAGAACAATACGAGCAAGCACTCCAGATGATCAAGGATAACCTCAAGCCTCTGAAGCCAACAGCTTATTCGGACAGTATGTACCTCG
CACCGTCCGCGTCGTCGGCATTCAATCTTCTCAGCGATTGTCTAGGCGACCTTGCTTATCATACAGCCGAAGAATCGACCGAAGACATGGGAGCTCGCAC
GATTGAGACTTTGGTGGAGGTGGGACTGGCGCGCGGCTCGCTTGCAACCATGCTCTTCGTGGTACTGTGGCTTATGAAGCAACCAGCAACGAGCTCGGTA
AATTTGGACACTTCGATATGTAAACTCGCTGCACTCAAAGAACAGCCAATGTACGGGAAGTGCGAGGCTTCAGGGGAACTTTACAGTTGCGGACAGAACT
CATATGGAGAATTAGGAACAGGAGATGATATTGAGCGGCATCAGCTTACCAGTATATCGCTTTGCGGGTGGGACGACATTCGTCAAGTGGCTAGTGGCAA
CGAGACACTGGCGGTTCTTACAAACGATGGAGTTGTGCTCACCTGTGGGCTCAACAAAAGCGGACAGTGCGGTCAGGGTCACTTTGATGAGCGCGTGATG
ATGCTGCGACCTGTACAGGCTTTGCGTTCCCAACGTGTGAAGTTTATTGCTGCGAGCAACGGATGTGAACACATGATCGCGCTGACCGACTCGGGACTCG
CGTACTCCTGGGGGTACAACGATCGAGGACAATTGGGCCATGAAAATCTGACGACCAAAGTCCACGTCCCAAAACTGATTGAGTCGCTAAAGGACAAGAA
ATTGAGATACGCGTCTGTGAGCTATCATCACAGTGCGGTCATCACGGACTCGGGGGAGCTCTATGCATTTGGCATGAACGATTGTGGTCAGCTTGGACTC
GACCACACGCAGCATCAGTCGACTCCGCAGCTTGTGAAGGGCTTTGAGGGCACTGAGATATCCATGGTAGCTTGCGGATTGTACCACACAATCATTTGCA
CAGCAACAGGGGGGCTGTTCGCCTGCGGCAAGAACGACTACGGCCAATTGGGTTTAGGCCACAATCGGCAGATCAAGGTGGCTTCGCTTGTGTCTCTTCC
AAATGAAATGGTGTCTTATGTCGCTAGCGGCTACTACCACTCGGTGGTTGTTACCAATAGCGGCCGAACTTTTTCATTTGGTCGTAACGACTATGGCCAG
CTAGGAATCGGAAACAAGGTTCACCAGAATGTGCCGAATGTCGTGGCATTATCTGCCAACACTAGGATGGTTCGAGCAACATGCGGATGCTACCACACTG
TTCTACTTTCCGAACAAGGACAAGTATTCGTCTTCGGGCGGAACAATAAAGGGCAGCTTGGAAATCGTGGCAGCGCTGATGCCTTACTTCCTGTTCCCTT
AAAGGTGCGACCGGAAAAGAACTCTCGTCGCTGTGTGGACGTCGCTGCTGGCTTCTATACGACCTCATTAATTGTGGAAAGGAAACGTGACAACGATGAA
AGCGACTCGATTATGCTGGAACAATCTTGTGTCATTTCAGTTTGCGGTCGTGTTGATATCGACCGCTCCGGAGAGATCGAGGGTTTAAGCAACTTTGGTT
CTATTTCCACGATAGGTGTATCGCTGTTCCGAGGGAAATGGTTCTACGAGGTAGAAGTGGTCACCAGTGGGTTGATTCAAGTGGGGTGGATCGATGGCTA
CTTTCAGGGGAGCTCCGATCAGGGAGAAGGAGTCGGTGACCACAATCACTCGTGGTCATACGATGGGAATCGCCAGCGCCGTTGGAACAGTGGATCGTCT
TCCTACGGAGAGAAGTGGAGAGCTGGGGATGTCATTGGGTGCTTGCTCGACTTAACCACGCAGGAGATGACTTTTTTCCGCAACGGAGTGAATTTGGGTG
TCGCCTACTCTGAATTTAAATGCTCTGAAGACGACAAACGATCCGGTATGATGCCTGGAATCAGTCTTGAGAGAGGCGAGATTATTCGCGTGAACCTTGG
ACACCAACCCTTTGCTTATCCTGCAGTTGGCCACGACTTTGAGAGCGTATCACGTGCAGTACAGCTGCCTTCATCTAGTGCAGTGATTCAGCCACCTGAA
GATCACACAACTGGAGGTTTCTCGATCGAGCCTCCACCGCTAGAAGGTTCCTCCTCAGTCATGATCGGTGATAAGCTATTTGTTGTTGGCGGGATGATTC
GTAACGAGTCCTCGCTGTCTCAACCAAACGAACCGACGAACCAAGTGTGGATGTATGACATTACTGCAAAACTCTGGGAAAGATGGACCGATTTTCCGAT
TGAAATCTGCCACCATCAAGTGGTTGCCGTTGACGACAATCACATTCTTGTTCTTGGAGGCGAGAAGGATTGTGCGGCGTCGCGGCACATGGATCTGTAC
AAGTGCTCCACTTTGAAAAACGCAGACGGATCGATGCCAACATGGACACTGATTCAAGCTGCGATTGGCGCTGCGACCGCTCTACCCCAGTCACGTGCAT
TCCACACAGCTGCAACAATTTATGCTCGCTTGGATACAATCGTCTTTATGTACGGTGGCAAGTCGGTCGACGACGAGATTCTCGGGGACGTCTGGTACTT
ATCTCTCGATGATTTCACTTGGTCGCGTTTGCCGAGTTCGGTATCACTTGACCCTGGCTCACGAACGGGATGCTCCTCTGCTGTAATTGGCGAGTCCGTG
TACGTCTTTGGTGGGAAGGATCGTGAAGACAAGTTTCGATCCGATCTCTGGCGGTACAACACGTTTGATCGTATCTGGCACTTGTGTCATGACGATAACA
TTGGTGCTTTGAAAGACGTAGCTGGAAGTCTAACTAGAACTGAAACTCACTCGATGCTTCCTGATGGAAGAGTAACTTACAGTATGTGCTCTGACTACGG
AAACATTTGGGTATTCGGAGGTGTCAGTCAGACCAATACTGTCTTGTGTGATATGTGGTACTTCTCCGTGTCTTCACAAAAGTGGAGCCAAGTTGAGGTG
AACACCCAATCAGACCTGGACGGATGTTGCTCGGCAGCTCTGTTTGTTCGACCGGGAGCTGTCACAGCCTTACCCAGCATGACCCATCTTGAGTCATCTA
CCTCTAACTGCGGAGATCTATTCCTTTATGGGGGACGTGAAAGTGCTAAAGGACAAGTTTCCTGTTGCAGCACAGTCCGAAAAGTTTGTTCCGGAAACAC
GTCCGGCTCATACAATCTTGATATCACGAAAACCATTTCGACGAATGGGAAATCGGCGCATGTACTTAGTGCCCTTCGTTCGAGGTGTGGGGCTACTAAC
AGATCAAGTCAACATTGTGCAGCGGAGGCTCTAGACTCTGCTGTATGCTTGCTATCTCATTTGGATCGCTTAGCTGGAAACGACGTCCCGACAGAAGAAG
CAGATTCCGTTCAGCTGTCCCGGTGCCTGTACCGTTCACTCTGTATAGACCCCAAGGAGGCGACTTTCTCGGCACTATATGCACTGCTGGAAAATATAAC
GACTCGCTTCTTCGGCATGGACGCACCCGATGAGAAGTCCAACTCTACATCACCGGTCACGCACGTCTTATATCCGATGCTCGTCACCATACGACTTCTT
AAGCTAAACTTCTTTGAGGTACGGACATTAGTGTCGCATCTTTTTAACCTCCTATTGAATCTCCATCTAATCGTCTTACACTGATTCTTTTGTAGTTTGC
GCGCAGTTGTTTGGACGGCTCCGAAATCGGATTACCAGCAACATCATATCAACCTGGGGGAGTTCTGATTTTGATTCGAGATGCGCTCTTCACGATTGCG
GACCACGTTCCCGAGACGCCGTTGTCTGGGGAGGCTCTTTGGTTCTACCACGCGATAAAACACGAAACCGCATCGGCAATCTATCACGGATTCCCGACCT
TGTTTCCATCCTTTTTGGATCGACTGCAAGTTATGAATCGCCTAATGGTAACCAACCAGAACTCTGAAGAGGAGATGACGCCAGCTCAGAAACTATTGGT
TCCGATGCTTGTGCCGTCCTTCACGTCTGCAAAAATGTTGTTCCAGTTGATAACCGATCCTAACGTGCTATTCACAGTGGATGGTTTATCCGACGAGGTT
GTTTCCGAAAGTGTAATCACATTCATGGGCACTTTGCTGGATTCACTTTGGGCGCAGACCAAGGATGCGATGGCTCACTCGTCAGAAGATATGACTAAGC
TCTTGCAGAGCTTAGAAGCCATTGAAACTAGCCACGAGTTTAACTGCCTCAACATTATGCTGCGTGCGGCGATATTCTGGTGCGAGTGCTCAACACAACG
AGGCTGGGTGATCATTGAATCGGTATGCGCAAAGCTGGTGGGATTCATCTCGGAGTGTCTTGATCAATGCAGCTCGATGAAACTCGATCACAGTCACCTT
CTTCCCATTGCCATTCAGCGCAGTTTTTCGGGAAAATTGCTGCCATTTTTGCTGCTGAGTGTTTTTTCTTTACCTTCCGTTCGTGAAGCACTCCCTGCTT
TACTGGATCCATTTTGGCCTCAGTTGGAAGCTCTCTCGTCGAAACTTCACGCTACTCTTGTGATCCTGAGCAAGCAAGGTCATTTGCAGCCATCTGGTGT
AGCAGTGGATGTCCGTCCTGCGTTCAACAACTGCGCGGAGACTGACTTCGTGGATACAGCGGTTGTATCTGTTTCACAAGAACTCACAACTTGTCTTTTG
AACCAGAGCAACACTAAGTCTTCTGTCACGTACGGTCAGATTTTGAAAAGCTTGTGGGACAAAATAACCCATGCGAAGGGCTACACGTCTTGGAAAGTAA
AGGAACTAACCCAGAATGAGGAGATCCGACGCGTAACTATCCCGTCGGACCTTGCAAAGCTTTTCGGAACCGATTCCTTGCTGGTGAAGTCTGGTCCTGA
ACCTTTAGTGGAATATGATTCAAGTAGAATCTCTTTCCTGCCCAGTCGAACTCTTCTCTCGCAGCATTTGTATCCTGTGAGCGAGGGTCTACCACCTACT
CCAGGAGCGACTGCAGGTCCGCCCCCAGCGCCACAGTCACTTGTAAAGAGCTCTCTTTCTAGTAGTACACGTTGCTCGGACAAAGCCATTGAAGACAGCA
GCGAGTGGCTTAAGGATCTTCAAAAGGTAGTAGTGTGGGTCGGGAGCCACTACGCCGCTACTTTGATACTCGGTGGTGAGCTTGATGGTGGCGTTGTCAG
CGAGAAATGGCTGCAATCCCCATTATTCCGTGGTGGATTAGACGAAACATGGCCTGATATAGATACCAGCAACAATGAGGTCGGTAGGAACGAAACCCTT
CTTCTACAAGTGGTTGAAAATGTCGGCAACGGCAAAAAGCTCTTGGATAAAGTACGCAATGCTCTGGATCCTGGATCGGCTCCGGGTGGCGGAAATCCTC
AGCTCCGAGCGGCGAGGCTAAAGAGACAAGACAGTGTGGAGGCAACACTTGAAAAAAGTGGTGGGATCGAGGCGGTCGACCGTGCGGTCCGTGCGACATT
CGCTGCTCTCTTGAAACACACCAACATCTCCTACACGACAGAACCCATTTCAAACCAAGGGAGATTAGCTGAAACGGTGGTTGATGCCTGGAAGGCTGCA
CTTCAATTGCGTCGTTGGTAAATGACTCGGATGGTTTTGTATTTACCGATCATAGAAAGTCAAGCTAACTTGTTTTGTTCTTAGGATCGTGAGAGAACAG
CAGAAACTAGCTGCAGTCGTCACGTAAGCTATACTTCCGTCAACCTTACCATTTTTTGCACTTTCTAAGTTATAAGTGTTGTGCCACAGTGAGACAGGGG
CACCTAGCGGGTTTTCTCCTGACATGGGAGTTAAAGAGCGACAACAGGCGCTGTATAACGCTGTATGCGAGCCTATTATCCGCAAAGCACTTGTTCTACT
TCAGTTGTCACCTGCGCCAATCCAATCCACCTCACCAGCTTCCTCTCCAATGAGACTTCTTCCTGGAATTTCGATGGCTACTACCTACGGTAAGACATCA
CTATTGCTGAGATTTGTGCTATGGCATCTCACATACCAGTTGTATGAACGACAGATTTCGCGAAAGCGTCTCAAAGTGGATCGGCTGAAACGCCAGACAA
AGAACCCGAAAAAAAGCGATTTACTCGTCAGCTTAACAAACTGATGGAGACGAAGTCGGTTGAAGTGATGGAAGAAGAAGATGAGCAGATACATGCGGAT
ATCTTTTCATTCATTCAACAGTCAAGCACGAACCTGGTGGCTCCCAATCAAGACACAGAAGGTCTTTCTCGACACCCCGAAGACCAAATGCGAGAAGTCC
TGCTTGTACACCAACATCGCGGGAAAATGCGTCTACAAGGGCTGAAGACATTCGTTCGTTTGCTTCAGTGCACTGGAAATATTCCCAGCTCTCGGCTCCA
CGTCATTCCGATGCTATCTTCTGCTTTTAAGCGTGTACGCACGGCTCGTGGGAATATGGCAGCCGAGCAATCTTCGATTATCAAAGTGCACTATCTCGTC
GACCTCGAATTTGCTGGACCACAGCTTTCCGATACGATTGGGCGAGAGTTTTTCCACTTGCTGACTATTCTCCTCGAGTCGTCAACTGATCATCTTCGTC
AAGTCCAGCAGCTCATTGACGCTGGTAGCGGCGGTTTGAGTGATATAAAGTCGTCGTCTACCTCTATTCAGCTCGCTGTACACGATATGCTACTTGTGTT
GGAGACTTGCTGCTTCCCTTACCGAGGCCAAGACTGGGATCATCTGCAGCGTACTAATTTGGTCACACTATTAACTGATTTGACGAGCTGGAAGGGCTGG
CAGACTTTTGTTCAGCACGATGCATCTGACAACTCTTCAGCCGATGTAAACAGCTCGGAGAAGTATGCCATACTTCCTGCAGCGACGGGATCGAAGTTTC
CAAACATCATCTGCTCGCGCTACATCACGCTTGGAACTGATCTCCGAAAGCTGACGATTACCCACAAGAGCCTCGAAGGCAACGATGATAGCTCCAATAT
ATCCCAGAACAATGGCGGGCTTGCGGTGTTTGACAAAAGTTTCTACCGAGGTCGTTGGTATTGGGAGGTGTCAATTCGTGCGCTTGGTGATATCCCTGTA
TTTGTTGGCGTCACACCTGGCACGACAGATCTTAACACGTACATCCCAGGCGATGGTAGTCTCTGTGGTGTGTTCCTGTATCGCGAAGGCTATTCTGGAG
ACATGGTTGGACCAAGCGGCATCCGCTTGAATCGCAGTGACGTTCTCGGAGTTCTGTTGAACTGTGAAGAGCGACAAGTTGAGTTTTACAATGGATCAAA
TCGGTGCTATGCGTTCACATTAGCGTCAAGTGATTTGGCAGGATGCGGCTACTTTCCGTCGATAGGTGTGACGGGAGCAGATGTGCATTGGAATCTCGCG
GCTACTGTCCCGCCAAAACTTTGGTGTGCTAGTTCTAACTTCCAATTCTCAAATGCAATCGTCTCTGCGGGGCTTGTTGCATCTCCTTTCGACGGAGCGA
CTATAAGTTGGAATGGAAACCGGAAAGGAGATCGCCTACAACTCATGCCAAATGGTACCACCGTTTGTGCTGGCGACTGTAGCTCGTCCGACGACCAGTT
TGAGACCATTGTTGCCAGTCAGGGCTTTGAAAATGAAAGCATTTTCGTTGAGATTCGCGTGGTGGCAACGGGGAAAGACGGACGCGCAGCTCTCAGCTTC
AGTATTGTTGGCAATGACTTCTTGGAATTTGATTCGCCGCTAAAGCAGAAGCTGGACGTGAAGTGGAGGAGCGCAGAGGACGTCTTGGAGTGGGGCATTT
TTGGGATTCTGTTTGATTTTGAAAAGGCCACTGCAACGTTGTACTCGGATCGCTTGGAGCCGGAAGTCTGCCACTTTAACGTCGCTGCGCTAAGCAAGCC
ACTGTTTCCTGCCGTTTCAGCTCTCTGCAATGGGACAGTTTTTGACGTGAACTTCCACCCACATCCTCGTCTCGAGCTGCCGTCTCACGTATTTTACCCG
GCTACAAAGCTCCAGAACCAGCTCACGGCCTCATCGACCGAGCTACAGCTAGGCAAGACCTTGCAGCTTCAACTATATTCGTGCGACGGTGGGGAGTTCA
GCAGCTCCCATACTGCCAGCAACTGCCTTGTGGATGACACGACAGTGTACAGCTCTGCGAAGGGAGCAAACGTAAATCTGGTGTTTAAGCATGAGCTTGA
CACTCCGATGTGCGTAAGCTACATCACCATACGGGGACCAGGACAAGGCTACTCAAGCCCCCTACGTTGTGCCGCTGTATTTGTCACCAGTACCCCTCCT
GATCTATCGAGCTATCAGGAGTTTGACAACATGACTCCAGAACAATTCGCTGCTTTGCCGTTCCCTCCGAGTAATGGATGCTGCCCACGTGACGAAACGT
TACCTGTTGCGCTCTTCGTACTGGACAGCAGCTGTACACAGATTTCTAAACAGCTCGCGTATCCAGCTACAGGACGGTACATCATTGTAAAGGCGATTCG
TCCTTCGACAGGAACCAATATCGATATCGGATACCTTGGGTTCTGTGGCATTTTCGATCGCGACAATGGACCTGCGTACGGTGAGACGACAACAACATCC
TATAGGTGCGAGGAATGCAAGAGAATGCCGTTGCCAGGCTTACATTACGGCCAACACGATGATGACAGTATCAAACTGTGTACCGCGTGCTACGATGACA
ATCGAGGCGATCTCGATTCTGCTTTCTATGTTTACACCTCCAGAGAATCGGAAGAAGATCAGATGGCTGTCAATACACTGCTGTGCCCACCACGAAGGTC
ATGGAACGATAAGATCGCGGCATTAAGCGACGTCTTGAGCAAGTCTAAAACACCAAAGGCAGCTAGAGATGGAAGCACAGCAGGAGAAGCTGGCAGGTCA
GAGATGCTTCCTACCGTTGCAAGCTTCGAAGAGTGCGAATTGTTTTCTTGCGGACAAAACAACTACGGAGAGCTTTGCTTGGGGCACTGTAACTCGACTA
GCAAGTTGGAACACGTGCCGTTCTTTTCTGCAAAAGGCATTCGTGACGTCGCTGGAGGAAACGAAGTGCTCGCTGTAGTAATGAATGACGGTGGTGTATT
CACGTGCGGTCTCAACAAGAGCGGTCAATGTGGCAACGGTACTTTCGAGGAGCGAGTAATTATCGCCACCCCTGTTCGTGCACTAAGTGGCATCGCTATT
AGTATGGTCGCAGCTGCAAATGGATGCGAACACATGCTAGCTGTTGCCTCTGATGGCGCTGTCTTCTCTTGGGGATACAATGATCGTGGCCAACTAGGAC
TTGGATCGACGATTTCGAAGAGTCATACGCCGCGAATGATCGACAGTTTGAGAGAAAAGTATCACATAACGACAGCAGCAGTGAGCTATCACCACAGTGC
CGTCGTGTCTAGCAATGGCGAGCTGCTCACGTTTGGAATGAATGACTGCGGCCAACTGGGTCTGGACCACACTCAACACCAGCATACCCCGCAAGTTGTT
GATGCATTATCGAGCCAAGTTGTTACCAAAGCTGCGTGTGGATTGTACCACACAGTAGCAGCAACAAGTGACGGTGAGGTGTACTCTTTTGGCAAGAATG
ACTATGGACAGCTGGGGCTTGGTCATGCTCGCAATATAAAGACACCAGCTCTGGTGAAGACGTCACTAGGGGAAAGCGACGAGAAGATTGTAGCGGTGAG
CTGTGGCTACTATCACACAGTGACGATTAGCGAGAAAGGTAAGCTCATCACGTGGGGAAGGAATGACTATGGACAACTGGGAATTGGAAGCAAAGAGCAC
AAGAACAGTGCGCAGTTTGTGCCCCTACCGATGTCATCAAAGATTAAGAACGCGTCGTGTGGCTGCTACCACTCGCTCATCCTCATGTCGAATGGACGGG
TAATGGTGTTTGGGCGTAACAACAAGGGTCAACTTGGAGCCGGGGCAAGGACCCTTTCATCTGCTGATCTACCTCTCCCAGTTCCTTCGAACTCGTTGGC
AAACGATGAAGTGGTTCGTATAGCTGCTGGCTTTTACAGCTCCTACATCCTTACCGGTCGCTCAAGCGACAATGCTGACCTTGACGGAGCAGCAGATGAT
GTGAATCAGTCAAAAGACCTCCCGGAGAATAGCTGTCTCGAGAACTCAGATGCACTTTTCGAGTCACTCATGAAGGAGATTGACTCTAAGTACGTCACAG
ATGTCGTACCAAAGCGGACACCGCTCCAACTCATGCGAGGATATTCGCAGCGCAAGTTACCGCTGGTGAAGTTACATGCTGCTGGATGGGCGATGGCACG
CGCTTTGATGTATCGCTCTATTCAAGATGCCGATGACAAAACCTCGAAACGTGCGGGTGGACGTGTGAATCCCGTGCTTTCGTTGTTCATAAGCTTTTTG
TTGGAAAACCTGAAATTATTGCAAGACGACTCTCTGTCTGGTGCCGTTTGGACGGCGACATCATCTTTTGAACTGGGTGGAAGTGTCTCGTTAAAGCGAG
TGTGCGTAGGGCTACTTCAGTACTTTGGTGCCAAGTTTGCAGTACCTTCACCAACGGTGGGACTGGTAGGCGGACAGACTCTGGACAAGCTTCACGGTCA
TTTCTACAAGAATCAGATTCTAAGTGTCCTCCTTGCGTGCGGCTCTGCGAACACGAACGTTGGCTCTACAATAGCTGCGAACCCTGTGGTTACCGCGCAC
ATTATTGGTGGAATGAATTCCTCCGACGTTGCGTCAGCAACGATGTGCATTCGACTGGCGATGCTGGTGTTCCCGCATCACTCTATGTCTGCGCTCAATA
CGATCTATCGATCGCAACAATTCACACCAGCGACGTCCGGGGATATTCTCACGATGCTGATGACTCTTGTGGGGCTTCCAATGCTCCTGCGACCACGCCT
TTGCTCGCACGAGCTTGGTTTGGAGTGCTCGAGCACAGCTTTATGCCAGTCAGCTTGCTGTCTGAAAGGGATAGCGGTGACAAAAGATACAGGGATTTCG
CACACACAGCAAGTTGTGCTGGAGAAGGCTCACGTTGCAGATTCGAAGGCGGCTGAGGTTGTGGCGCTGCTGCGGTATCTCACACTTTATCCGACGTGGA
AAGTAGCCATCAACGCCGCAATTACTCGAGGTTTTGCCAGGTCAAACAAGGTTGGAGAGTTGCTGGATGCCATCTGCGCATACTACACAAACGTGCAGCA
GGCGGATATTGTGGATCTTCAAACCGCAGTACTTGGCGGTCTAGCAGGAGACAAAGATGCTACGTCGCTGAGAAAACCTGAGTCGACTACTTCGTCGCCC
GAGACGGACGAGTCGGTCAATAACACAGTGGATAGTAACACCCAAGCTGAAGAATCGGAGTCTACCAGTCGAGATAAACAATCGCTACTGCTTTGGCAAA
AAGCGAAGGATGCTCTGGACGGGTTAGCGATGATTATAGCTGCCGTTAGTATCGTCGGTGGTCATGTCGAGGGCTTCAGAGAAGGCGGGTGTGTGACTAT
TGAAGACGATGGCACCCAGGGCTCGCGTAGATTGGGTGTGCTTTCGGGTGTTATGCGAGATCCACGCACTGCTGATTTACTGGCTCAGGTGGTCGTGAAC
TCCAGTGCTGAAGCTCCAGTTTCCCCTTTGATTCCAGCGGATGCAAGAGCCCAGGCTTTCTCGTTATCGAAGCTTCATGTAGTGGAGCGCGTTCCGGCAC
TTGTCGACATGTTTGGGGATGTTGAGGGCATCATTACGACGTTGTCATCGCTAGTTTCTGAGGTTTTGTCGGTTGATAAGGAGTGTGCCACGCACTGTGA
TCTGGAGCTGCCTCAAAACAACTCTGTCCAGGAGGTTCTGCGGAACCGGCTTAAGATGTACAAGCATCAACTACGGTGGAGATCAGCAAAGGCGTTATCG
TCTTTACTGAAACAGATCTCGACCCTCAGTCCAACGCAGTTAAGTATGGATTCCCAACTCGTATCAAGCCTGGCCTCATTGCTATCGTCCGAGAATTCGC
TTTCGTGGGCCAGCAAATCCGAGGTGACGGGACTAGAAACTGCGACTACTCTTCAAAAGCGATGGATTTGTGTAAAGCAGCGCCAAATTTTCTTGGATAC
TGAAGAAGTTATCGACTCTGCATTGGACCATTATGAAGTCGAAATGCGCGACCAAGTTGTGCAAAAGCTGGGAAGTGAAAATGCACTAAGCTGGGGAATG
GATGCCATCCAGTCGCCTCGCCGTAAGGTTACTCATCCGTCGTTTGCAGGCTCTGGTGGAGCGAAGCAGCGGGCTGATCGATCCAGTGATGGAGATCTGC
CGTTTGGTACGTGGGGTATTTTGTTGCCTCTACCACCGCTTAATGAGAACGAACATGCGGTTGGTCCGGGAAGTTCAGCCATCGACTACACTCCGTTCCC
GCTTACGGCCCCTATCATCCGTGTTGGTCGTGCTGCCGATGCGTGTGATCTCATTGTGAATGACCGAAGTGTCAGTGGCCGCCACTTCCACCTACGACGC
TTGCGACGTGAAGCTGAGGGAGGTGAAACACAATTTGAGCTTCAGGATTTCAGCAAGAACGGCACTATCGTGAATGGTGTGAGGATCCATGGATCGAGCA
CTCGAATCACCACGGGATCTCGGATCTCGTTGATATTGTCCCGAGGTGGATTGGTGACGTATGAGTTCCAGGTCCGTGGAAGCACAGGAGGTCGTCACCC
TGCTATTCTCACGGGGTCACAAAACCCAGGCGACCTGAATATTTCCATTCCTGGCCAGGAATACCAGCAACCACAGATTGGCACACCCCAGATCGTACCA
CGGAGTCCTGCAGAATTGCAAAACCGCGGGAACCGTGGAGGTGCTGTCCCTTTGGAGAGTGTCGCTGATAACCGAAGCCGTCAGGCAGTAACGCAGGGTT
TGAGAGTCATCACGTCGATAGCAGAAAGCGATGTTCCTCGTGCTCTACTTTCGCCAAACCCAGCCATGGATTCCCCCCGAGCTGGTGGATATTCATCTCC
TCGATCTTCAGTTCTTCAAGCACCTGGTACTCCTTCTGTGGGACCTCTTACTCCAAGCATGTTTTCCACCATAATGCCGCCTGCTCTACTTTCTCCTGCG
TCCTACCAGCAGCGTGAAAGTGTTGCACCAACTGGACCTACAGGAGTCACATCTCCTCAAGGAGGTGTTGGGTCGATGCTCCGTATTGCTCTAGGTCGCG
ACAGTGTCAATCGCGAGTCCCGGCCTAATATGCCGAACGAGCTTGCCAAGACTCGAGTCTTACGCTCTAGTGGGCAAATCGGTTTGACCACGCGTTCGGT
ACGTCTCACGTCTGTTAGTTTTGAACACTTTTGTGAGATCTAATAGGTATCCTTCCATCTATTGTCCCTTCAGAATGCCAGCCAAGCACAGGAGATGCAA
GTACTCGCACTACGTCTCCTTGCCCGAACTCAAGACGCCAACCTCGTTGTCAGTGCTACTGAGTGCGAGGAGGCACTTCAAGTGACAGCTGGCAACTCGG
ACGAGGCATTCGTGATGATCCAGCGAAGTCGCGGATCATTCTCGGTATGTGAAATGGTTACTTTGCATATCGTATTGGCTTATTACGCTAACCGATACTT
TTTTTTCTAATGCTCTGCAGCGCAATTATTCGTCAAATGTGCGTCACTTGGCGATGGTGCTCGGCCGAAGTGAACCAGTGTGTGCAGAAGCACTGCGTCA
AACCGATGGCAGTTTTGGTGACGCATTGCGCTTGCTTCTGACAAGCAGAGCAACTGAGCCGGAGAAGTCTGTGTTGTCACTCAGACATGTAAGCGCCAAC
GAGGCTCTGCAATCTAGTGAGCCACTGGTAAACTTCCAGGACATTGGTGACGAGAATCCGAGTTACACTCTGACTGAGTCTAGTGCGCTACATCCACCAG
CTCCTCCGCGTCTAGCGGCCAGATTGAATGAGAGTCCTGTGAAAACAAAGAAGATGGAACACACGGGGAACGTAGATGCACTCCAACCGAAGTCCGATCT
GACACTGTGGAGTGAATGCAACAGTAGTTTCGACGAATCAGTTCGACAGATGAATTCGTTTGAAGTCGAGTTGGAGGAGGAAGTACTCTGTGAGCGTCTT
GCTGCTATTCACGCACGAAAGATTCTTCTTCAGATCGTGAGGCTCTTCACGCACGCGACGCAAACCGAGGAAGCGCCTCTGAGCGAACTAACGGACCCTC
TCGTTCTTCGCTCCTTGATATCGATTCTGAATGTACCCGGACAAGCTAACATCAGTTCACCGTACGAGCTGGAGTACCAGCTGCAACAGCAACCAAACGC
TCGAAAGAGTGGTAAAATCCAGCAGATCTTGTCTCGTATGGTTAACGACGTGATGGCTCGCTCCCCTACAGAGACGTTGGCCAGAAACTTGTGCTCGACT
CAAGACTTGTCTACTCTTCAAAGATCCATTGACCAAGTGACCGAACGACCAACGAAGATTGGCTGGACAGGTATCACGAGACTCATCGAATCTCTGGTCG
AGAACGAACAAACCCGAGGAGAGGACGTGAACGGCCAGAGTCCTCCAACCACGTTAGAGAATCTCACGTTTGAGACAGTCCTACACGTTCTTTCGCGCAC
GTACGCAGCTCCAATGGCAGCTCTGGACTGGGATAGCTCTCGTCTTCGAACCCGCAAAGCTGATGGCTCTTTCCCCAAAGGTCCAATACGTCTTTCGTGT
GGTCTGGAAGTTGTAGTGGTGGACACTTATGAGCGTTTGTGGAGTATCCCACCTTCTGATCCCATACTTAAGCACCGTCACAAATGGCGAAAACGGTTCT
CTAGTGGTATGGAGAATGGATGGATGAAGTCAGCAGCAGATTACGCCGTGACAATTTGGCGGCCGGCACTACCCCCAGGGCTTGATTCGGCTGCGTCAGG
TTCTAGTTGGTTCTGTCTCGGTGACGTTGCAAAGTGCGGTAATGGTGCTCCCGATGCTCCAATGCTTCTTGTCAATGACAGCGACAACCATGGACTTCTG
GCACCTCCAGTTAGTTTTGAACGAGTGGATATAACCGGAAAGGGTTTACCCAGAAACTCAGAGAGTGATCCAGATTTCCAACGTAAGCAGCTTCGCTCGA
TTTGGTGGCCTGTTGCGCCGTCCGGATACGTTGCGCTAGGCTGTGTTGCTGGAAGCAAAGAAGACCCCTTTGAACCCCCAGACGTGTCGTGCACCCGCTG
TGTACGCGAAGATATTGTGAAACAAGTTGACGGCTTCCACTGCGTGTGGCGTGCAGAGTCTCCTGTATCCACTGGAGGTGGAGGAGTGGAGCTTCCAACT
ACTATTGAGGTTGAAAATGACGAGGAGAATGAAGGAGAGAACGATGGTTCGGGTCACGCTCTTGGTAGTCGTAGCACCAAGAACCAGTCTCCTGATTCCT
CCCGGTTGCAGCTGCTGCTTCCTGTTGCTGATGATGTTGTCGTTCAGACATCGCTTTGGGCGGTGGACGCAGACTTCAGTTGTGGTCTACTTCTTCCAGT
CGTCACACTAAACGATGCGAGCGCGAATGATCCCGGCACTGCATTCGCTCTGAATCTTTCGGATGACGATCTAGTTCTTTGTGCTCCTGTAAGCGTGGAC
AACGTGCTAGTATTCCTCGAGATATTGCTTCAGTACCAACAACTGCAGTCGACAAAGCAGCAAACTAAACAGATTTTCTCGACTCAACTGCGCCCTGAAC
TGCCCGCCGCACTGTTTGCTCTGATTCAGCAAGTGTTACGCGAGAATCAACCATCCAGTGGGAAAAGTGCTGTGTCGCTTGTGCGTGCTCTAATTTCTGT
AGTACAGCGTGGTGCGCTTTGGTATGACAAGCAAGCGCTTCTTTACTGTCGCTCTAAGATTATGGCTCTGAGTCAAGACCACGACGGCGGATTTACGCTG
CATGCTCTACTACAAGCTTTCGTGGAGTTGATGCTAGCTGTCGAGGATCAGCAACACAGTCAACGAGTACAGGAACTCGCTGCTTGCTTGGATCGCGATG
GTGGTAACTCACTGAGTCTACCGTATCGCTTCCACTTCGCCAAGCAGCCATTCGTGGAGATGTTGGTGAGCCATTCGTCAAAGATGGCAGTCATGCGGCA
TTTGTCTGGAGACGAGCGTAAGTTCTTACTAGATTATCGCTCTGAAGATGGCAGCAACCGAGACGCGCTGGCCGTTGAGGGACTGGGTTCTCCACCTGGG
GAAGTGTATTCGTGCCGCTTTGAACATACACCAGCTCTCGTCATGACAATGCGAGACGAGGTGAAAGCTGAAATTGTGTATTTCGAGGTCACTGTCATGG
AATGGAGTACTAATTCTAGTATGGGAGGGTCGCTTGCGCTTGGATTTTCGCCTCCGCCATTCCCACTCGAAGGAGTGCTAGTGGGTGGTAGCGCAGATGG
CTCACGCTCTTACTCGTTCGCACCAGCGAACGGTCAAGTACTCTGCGCAGGTGACACCGTTGTGGATCGCTGGCGATGGATTGAGCCTGGTGGTGCTGTG
AGTCCTGGAGATGTGTTTGGTTGTGGCTTACGACTTGATACACAGGAAATGTTTGTCTGTAAGAATGGCCAGCTGCTAGGCACCGCCTTCTCGAGTATTG
CACGGCCTCAAGAACTCCACCCAACGATTTCGTTTAACGCAGACTGCAAGCTACTTGCCAACCTTGGAGCTACAACAGCAACACCAGCAAAGCACGCGAA
CTTCAGCTTCAGGTTCCATTCACTAGACTGCGACAACCTCATGAGTTCATTCGAGTGGTTCGAGCCACTGAGTCAAGTTTACGGCGTGATGAAGGCGTTA
ATGGACCCAGCGAGACCGGACAACGTGGATGCTCGTGACGAGCCAACCGATGAACTCGTTAACACTGCTGTTGTGGCTCAGCTACCCGATGAATTCATGC
TTTCAGCTGACAATTTCCTATCGGACATCTCTGAGGATGTCTGCATTCGCGTGGAGAGTGCACACCCGTATGATCTTGAGCTTCAAGAGTCCCTTGTTAG
CATTCCGCTAGCTACAAGCATCCGAGTTCGGTTGGATCCTCAAAGTGAGACGGCCAGCTCTCACTGCTTGCAGATTCTACAAGGCGGAAGTACAATAGGA
GGTGAAGGCGAAGGTACAACAACCGGAGAAGCAGAGATTAGAGCATTTACGGGTGCTTGTGGGGGTCAAGAAGTTACGATTGACGGTGACAGCTTCGTGT
GGCGATTCCCCGTTCAATCCAATTTCCAGTGTCGTGTGGATCGTGTACGCAAAGGGCCTTATATTAAACTCGAAGCGCGAGATACCAGACTGTCACTAGT
GCGGGATAAAGGCTGGCAAACAGCTATCGGTGTTGCGCGATTTGATGGAGGAGTGCACATTTGGGAGGTTCGCATTTCTTTTGTGACTGCAAGCTCCAAT
ATCTTCTTAGGTATCGGTCGCCGAGATGTTCGCTTGGACTCGTACTTAGGCAAGGATAACCGAGGATGGGGATGGATCGGAAATCGTGCACTCTGGCACA
ATGGCAGCAAACAACGTGGCACTTACGGCGACAAGTTTAAGACGGGAGATATTGTCCGTCTCACACTGGATCTACGTCGCGGTACACTTAGTTATGCGCT
TAATGGAAAAGATCTGGGTGTCGCGTTTGGTCCTGGTGGTACTGGTCCGAAGCTGGAGGGCACGTTCTACCCTGCTTTCGCGCTGTACAACCAACGGGAC
TCGATTGATCTGATCGGTGGGCATCGTGTAGAGGACGGAGGACTGGAGCCAGGGCTCTCTCGAACTGGCAGCGGACTGGCAAGTGGAGAAGATTCATACT
ACAGCGAAGAAGAAGAAGATCTAGGAGGTTTCACCAGTGGTGAGGGGGATGGCTCTATCCCGAATTTCCGGATGGAATTGGCTATCGCACTCAGTCAAAT
GGGGTTCCCCATGGAGTGGTGTCTCTACGCTCTGCGTCATTGTGAAGACGATGCTGAGCAGGCTGCGGATTATATCTTAGCCAATATGCACGCGATTGAA
TCGCTTGTTCGGGAAGAAAATGAAGTCACGGCACGTCGCACACGACACCGCCAACTACTGCATGAACAGGCCTTAGCTCTGTCTGAAAGCGAAGCACTAG
ATACTTTAATACCGCCTCCACCACCTATCGAAGACGACGACGATGCTGTTCGCTCCATGGAAGAGGTAGCCTCTACAGGCGACGACGATGCATCCACTTT
ACCTCTGCAGCAACAGTCAAGCGGAGACACTAAATGGGGTGTGGCGTTTACAGCTGTACCCGAGTTCTCCGTTACTGGACGCCGTCTACTGGCAGCCAAA
TACGGTCCCAAGCTGCGTCGATTACATGCGTCGCAGCGAGTATTCACTCCAGCACGTGATCACGCTCTCGTACAACTTGTAAACGAGATCTGCGAGTCAC
GTGCTGAGGCATTACAAAGTTGCGATCCTCTCCGCATGACTCCTGAGGATTTCGTCCCGACCGAAGAACAGATCCATCGATTCCCGGCTTTACGAGGCAT
GCCTCTCGAAGCACTCCAGCGTCGCTTTTTGGTGCTGCGAAACTTCAATTGTCGGCTGCAGATATCTCTGGCTTTCATTGATTTCTCGGCTAACAACGAG
CGTTCTCTTCTGGCAAGAGGTGCACGTGAACTTCGTGGCGTGGTCTTCCAGCATGTGAAGCTTGCGTGGTGGCTCGGTGTATTGAAAGAGCAGCAAGCTC
CTGCTGCAGCTCGTCCAGAAATCGAAGTCGACCGTCATCGTGCTCACGACGCACTTGAACTTTCTGAGCGTGGCGATCCACTTGCTGGTGAGGCTGGCGA
GCGGGATAGTGTGTTTGCGCAGACGTTTGAACAACTCCACGGACTGCAGCCAGCATTGCTGCGAGGGGCTGATAGAGCCTTCAAATGCCAATTTGTGGGA
GAGTTTGGTGACGATTTTGGTGGCTTGTACCGTGAATGCTTAGCTCAGCTAAGCTCCGAGTTGCAGACCTTCACGCCACTGCTGCCTGTGCTACGCCCAT
GCCCTAATGAACTGATGAGCACAGGTGAAAACCGAGAGCTTTACGTTCCTAACTCCCACTTACGCTGTCACCCACGCCGAGTGCAGATGGCAGAATTTCT
CGGGAAACTTGCAGGTGTGGCTGTGCGGACTAAAACGCCACTTGATCTGAATCTGCCGCCTGCTGTATGGAAGCTCCTAGTGGGGCAACAAGTGACCCGC
CACGATATCGAAGCTATCCATCAAGGATGTTTCCAAGTCGTGGATACTATCGCCGATCTTGATTCTCACGGTATTACAGAAGACATGTTTGATGAACTTG
TAGACGCAAGCTTCACCGTGCTATCTAGTACGCGGGAGACTGTCGAGCTGGTGCCGGGTGGTAAAAACTTGCACGTGACGTGGGGAGACCGGGAAGAATA
CGCATGTGCAGTGGAAACGTACCGTTTGACTGAATTTGCGCCTGTGTGTGGAGATATCTCGCGAGGCGTGGCGACTATTCTACCCGCACCAACGCTTGGA
ATTTTCTCGTGGCATGAACTGCGGACTTTAGTGTGCGGTAAAGCCACAGTTGACATAGCTCTTCTACGCCGACGGACCATATACGGTGACGGCTGCCAGG
GAACAGACCCGCACATCGCCTACTTTTGGGACGTTCTGGCAGAGTTCAGTGATGAACAGAAGTCATCATTCCTGCGCTTTGTCTGGTAAGTCTGCAACAT
CATTACGTCTTGTGACGATGAGTTGGTCTAATTTGTTGACATCATTTGCGTGGCTTACAGGGGTCGATCGCGGCTGCCGACACATGCAGCAGATTTCACG
CAGGACTTTAAGATTTCAGGGCTACCCAAGGCTGCAGGTCGTGCCGACATGTACCTGCCTATTGCTCATACCTGTAAGCTTGTTGTGATCTGTTGCGTGT
GTTGTTCATGTCTCTGACAGTTCTGAGTGCCTGCAGGTTTCTTTTCGATCGATCTCCCTGCCTATTCGTGCAGAGAAGTCATGCATGACAAGCTGGTGTA
TGCCATCACTCACTGCCAGTCCATCGATGCGGATAATACGACCGTAGCTCAACGAGCTGGCCAAGGAATCAACTGGACCAATACTGCTGCTACAGCTACA
GCCACTGCAGCTGCTGCAGTGTCGAGTGTCATTGCTGGAATGACTTCCGTTAGTGGAGAGTGATCATTGCATCGCCACGAAATACATTCTTAAGAATTCA
TATTTTTATTTGAAACGATCAATTTCACATTCCTAGTAAACAGTCATTTTCAAGTTGTCTTTGCACTGGTCTGTTTGTTCTTGGGTTCCTTTTTGCGGGT
GATCCGAGGAGGAACAGCTCGCTCGAATGCGCGTTTCCAGTCTCCGTGATTTGCTACCTCATTCAGCACAATAAGGACAGAATCCAGATTCATGATATGA
GTTCGCACGCGTGACCCCAATTGCTCAAAGTGCTCTTGAAGCGGCAAACGTGCGGTTCGAATGCCACGTGAAGCTGCCTTCGTTTTCGTCTCGCCCTGTT
ACGAAACACCGGTGTTAAGTTAGCTAAATTGTATCACAGCAACATCCTAAGCAGACCCACCTTGCGAACAGAGCGATCGACGATCCCCCCGACGATGTAC
ACAAATGCTGGATCAAGGTGCTCCAGTACGTTGTCTGAATCTGGCGAAAGGTACACGAGCTTATCAGCGTCGTAAAGCTGCTCGAGCGGTTCTTCATGTC
TTCCAATCTAGCACACAACATTATACGATCAGTACTATCCTATTAGGTACGCTCTAAAACTTTTGCGTACCTTCCAGCATGCTGCGCACAGATGCTTGCA
AGTCCTTGGGTACAGGACGCAAGGTGTAGCGATAATAACCGGTCCAACGGACAGGTCTTCAGATATCCGTAGACACACCCGAGCTGTTTCAAAATACTGT
GACTCTCCTTCAACAACAACATGCAACGGGTTAGACCTCCGACGACTTGATGCAGTTAACCTGCAACAAAACCTACTCTTGTCGTCTGGTCTAGCGCAAA
GGCCAAGTCGACCACCACCTGAATTCCACTTGACTGAGCTTCCTCCAGCTTTTGCTGCAACAAAGGAACAGTAAAATAGCATCGGCATCACGTACGAACT
CCGATGTAGCGACAAACCCACGTATTGTTCCACGCGCTGCATGCGAATCCGCTCACGTTTCTCGTTTTTCTCTTCCCCTGTCGTGTTTTCTCGTTCAACT
GATAGCGTTAAACTTCGCTCCAGTTTCTTGGTCTTCAGTCGCTCATCTTTGCGATTACGTCGATTGGAGCGCATCATTTCACGTCGAGATTTCTTGGTAG
TTTTCTCTGGTTTACTAATGTATTGCAAACCATAGCGATATCCACGCAGGCCTAACGCCCAACATGTCGAGACGATCACTACGCCCAACACTACTGACGT
GACTCGCATATTATGCAGTCAAATATTATTTGCGTGACTTCCATGTGATTGGTTTCTAAAACCTTTTTAAGCGATATCATTGGGCGATAATCTGCTGGCT
CTGACGCTGTAGCAATCGTGGCCACTAGCTCACTTGGTGATGGCAAAGAAGCGTCGACGCTCCGATAGCTTCCAGGCTGACGACGATGACGCTCGTAAGA
GGCTAGCAGCTTTCCACGCTCGGATGTTTGAGATGCCACAGGAAGATGCGCCTGCTGCGACACCAGAGACGCCCCGCGTAGCGTTTAAGGCAAAGAGCAA
GAAGCACAAGAAGAAATCTTCAGAGGCAGATGATGGAGAGCCTGTGCCTGTGGTTAAGTTCCACAAGGTGCAGAAAAAGAAAGAGAAGAAGAAGAAGCAA
GTGGCAACTGTTGCGGATAAAATACTAGTGAATGGTCCGTCAGTCGTGAAAGCTCCTGGCGTGTCGAATCATGTTAAGAACAAACCACAGGGAAATAATA
CTGAGAAGAAGAATAAGATGATTAAGACGAACGTACGAAACCCACAGCGGAACCGCATGAAGAAGAACGAGGTAACACGAGAGGAATATGACGGAGTGGA
TCCGTTGGAGCAGGCGCTGGGCAGTGTGCAAGCGACGGTAACGGTTAGGAAAGTGAAAAAGGTGAAGAAGAAAACGGTGCAAAGTCCACCGATACATTCG
GTGAATGTAGAGAAGGAAGAAGAGGATGACGAAATGGATCCGTTGGAGCAGGCGTTGGGCAGTATTAGCGCAATGGTGACGACGCAGGAGGCCAACTCAC
CGCCCAAGAAGAAGCGCAAGCATGTGCTCCTTGCTGCACCGAGTGAAGAGAAGCAAGCTGATATTGTGGATATAACTCGCGAGAAAGAAGCTCCTGCAGC
AGTTGCTGTGAAGAACGACGCTGCTGGTGGCGCGAATGTAGCCAATTTGAAGAGTAAAAAGAAGCGAGACAAGAAGAAGCGGAAAGAAGCGGCCAAGCTG
GGATTAATGAACAGCATTTCACCCAAGACACAGACATCTGCACAGCCTAGACAAGGAACTCTGCTACTTGTGTCGGACGAGGTAGAAGATCAAGTTGTGA
GCAGCACAACTGCATCCAAGAAGCCCAATTCAATACCATCCAAAACGGCGAAAACTGCGCCGACTAAGGAGGATTCAACTATTGTCAAGACTGTTGCTGC
AAAGAAGAAGGCTGTTCCTTATCGGGAAAAGAAAGCTGAGGCAACAACAAAACCGCTGACTCCAATTGCAGCTTCCTTAGCTAAGGATGCGACAAAGAAG
AACGACATGTTCGTATCAGCTCAAGAAACACAGTGCCAACGTTCACCTTCGCCGAAACGCTCAGGAAAGACTATACCGTCTCAAGTCGTTCAGCTCGCTG
ACGCGTCTGCTTCATCGGAAAGCGAGGATGACTTTGATCGCCGTGATAATAGCGACTCGTCATTTTTTTCTCGGCTCATCGACTCTGCTGCTCGAGAACG
ATGGGAGCTGGTGGAGGTCGGCCGTCTAGTTCGACTGTTTGCTGCGCAGTGGGATTTCAAAGCGAGCAAGACCGCGCGCTTCCTACTCGATACGTGCCCA
GAGCTGGTTAGTGTGGACTTTTTGGAAGGATTGGGTGTGAACTTATCGGCAAAACAGCTCGTACAAGTCTTTGAGGCCGGCTCGGGTAACCCCGGTGTGA
TGATGAACAAAATGGCATCGGCTGTGGAGAATGGACACTTAAGTGTGCGTGACCCGTCCTTCGTCTCAGCTTTGGAGCGTCGTGTCGCGCTGATGGAGTC
GAACGCTGAGGTTATGGAGCTACTGCATCCACTACTAGAGAGCTTGTCTACTGTCCGAGATGTTGGTTGTTTACTGAAGCAGCTGTGCGAGCACTGGCAA
CTTGAGCGCAAAATCTCCTTGGTTCAGCAGGTTCTGCTGTCGAACGTTTTCGACGATCTAGACGGCAACCAGGATGAGATTCTTCTTGACTTGCCTGATC
TTACTGGACGACTGGACTTCCCTAGCCGCTTGGACCAGGAAGATGTTGATGAAAATGGCAATCTCAAGGGATTCCTTGCTAACGAAGACAGCGAGTTCAG
TGGAGAAGAGGGATCTGAAGAAGAAGAACACGAGAACGATAGTGAAGACGACGAGTTTCCGTGTGAGGGTGAGACCGACTCGGACGAAGAGATGGAGATA
TCGGGGTGCTCTCGTAGCCGCAACCAGTTTATCGAAGACGAAGCCGATGTCGGGGAAGATGAGGATGAAGAAGATACAGAGAATGAGAACGAGCACCTTC
ATGACGATGGATCATCGTCTGATAGCGACTGAAACGCGAATGAAAATACAGTTCGGTTCAACACAATCCCTTATTGCAGGATGAAAGCTTGCGACCCAAG
TCTACGTCGAAAACATGGCGTTTAAGGCCGCCAGAATAGCAAAAATGAGGGCAACCCACATGTACGGAGCCATGCCACTGCCTTCCTTGGTGTTCTTAGA
CACCTTTTTCTTTGCGTGAGCAATAGCGGCTGCGCATTTCATCACACGCACACAACATGTCATGTTAGACCGATACATTAGTAAATGTACAGGTTTGCAG
GCAGAGAAACCTACCAGCACGGGCTGCAGCAGTCTTGTCTTGGTACATTTCATCATCGGCGCCCTTACCACGACGACCGCCTTTCTTTGAGGGCTTGACA
GCAGACTCCTCCACCGGATCTTCCGCATCGATATCTTGCTCAAACGTTTGTTGGGCAGTCAAGCCATTCTTGTTCTCCTCGGATATCAAATCTGGGAACG
CAGTAGTCAACACCTCCGCAGCCGCAGTAGGCCAGTTTGTAGTAGGGTCACAGTGCATCGCCTCCGAGTGCAGCGGCGTATTCCCATGAGTGTTCTTGAC
AGGTTTAGCACCCTACACAGACATTGTCGCGTTAAATCTGAACAGTACCAATAGTAAAAGAGCGAAAGTACGAACCTTAGAGATCAAATAGTTGATCAGA
TCGATTTGGTCATCGCCGTTCTTGATACACGCCCAGTGCCTGTAGATACCAGAATTTAGTATCATCTACCTAAATTCCAAACGTTTACAGCACCCTTACA
AAGGTGTGTTACCCTTGGCGTCCACCACGTTGACGTTGGCACGACCCGTCTCGATCAGCAGCTGGACGATCTCAAGATTGCCCTTTCCGACGGCGACATG
GAGCGCCGTCATCTTCTTGTTGTCGACTGCATCCACCTTAGGCTTTGCTCTTAGCAGCAGCTTTAACGACTCCTCCTCTTCATACTCTGCAGTCGCATAG
CATAAAGTTAGTAATCTTCTTCAGCTCTCCACTGTCGCTGCATATTGTACCGGCAGCTAGATGCAGAACGGTCTGGCCCGACGAGTCCTGCACACTTAGA
TCGGGTTTGCCTTTGAGTAGTATCTGGAAAATCTCCTCAAAACTCGGCGGCTGCTGAGCCAGCGCCAGCATAAGCGGTGTGAAGCGACGCTTCTTCTCCT
GCAGATTTAGCATGGCACCATTGGACACGAGGTGTTGCACGATCTCCAGCTGATCTTCGGCCACTGCCACGTGCAGCACTAAAAACGAGGCATTTTTTTT
CAATCAAATAAACGGTTAGTCGTGTGATGCAGCAGTCGTAACGCGGGTATGATTTTAACAGCAGCATACCGGACTCGCCCTTCTTGTTCTGAAAGCTCCA
GTCACTGCGCAGCTCGATCACCTTCTCGAGGTTCCCGTTCGCTG