Description :
From Genome Similarity Track
Location :
Scaffold_145:17588- 19989
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_145-abinit-gene-0.89Pseudouridylate synthase
Pytap_DAOMBR444maker-pag1_scaffold_145-fgenesh-gene-0.12Glycosyltransferase family 4 protein

Sequence
2401 bases(100 bases per row)
CAGCTCCGATGGTGATGGTCATGCGgaTGACACCGTAGCGCTTCCACCACAGGCCCCATGCTGGCGCTACTGTCTGCACATCGCGTACTTCGGCACCGGC
CTCGTGGGGTGGCAGCGCCAGATCGAGACGAGTAGCTCCGGGCAAGGCAGCaTTCAGGAGCTGGTCGAGCACGCGGTGACCACGACACTCGCGGCGCCTC
GGCGCGTGAACGTCACAAGCTGCAGTCGCACAGACGCCGGCACGCATGCGCTATACGTACGTCTCATATAGCGCGTGGATTGGTTGATaGCGCATTGACA
ATTGATGTAATTGTAGCAATACGGGACGATCAAACTGGACCACGAGCTCCCGATGGCAGTTGCAGACTTCCAGCAGCAATTGAATGAGAAGCTTCCCGAT
GGAGTGCGTGTCCTCAGTGCCGGTCCGTTGCCTCCTTCTGTTACCCCGTCTCGGTTCCGCTCCAAGTACAAGAAGTACATCTACTACATTCAACAAGGCC
ATCgCCCAGACCTCGAGCTTGGCAAGTACTCGTGGTTTCTCGGCCGCCGTATCGACGTTGACCGTCTGCAAGAGGCGCTACAGTAAGCAGTTGCGTCGTA
CcAACAACGCCAAaGCCATGTCTGATCGATTGTTTtCTATTGCCAGGCACCTCGTTGGGACGCACGACTTCCGGCCGTTCTCCCAGGGGCTCCAGAAGGC
CGAGTTTGCTGATCGCTCCACAGTGCGCACGATGATCTCGGctCGAGTCCGTGTCAAGCGGTACGTTGATCTTTGAGTAAGGCTAATGGGATGCTGCACT
CACGTGATGATTCTCTCGTGATAGgAaCGTAATATTCTCCCTTGACCCGGAGACCTGCGGTACAGGAGATGAGGTCGCCGACGTCGCCTCACTGTATCTT
GCTCCTCCCGTGCAGAGCGCTCCAGAAGGTAACGATGATGCCCACGTCAACAAGAAGCGCAAGCTGGATACGAAGCCAATCGCACCGGTCCATTTCGTGT
GCGTTGAGCTCATCGCGACGGGTTTCCTCCGTCACATGGTGCGTCGAATCATCGGCACTGCACGCCCGATCGCGgAAGGCAtGTACCCGGCAGATCGCAT
GAAGCAAGTGCTTGAAGGACAGCTGGAGCCTGGACCATCAGCACCAACCAAAGGtCTTTGGCTGCATCGCACGTGGCTCACGCAGGAAGATTGGGACAAT
GACACAACGAGAGAGCATTGAAAGCTGGTATAaCAAAAaGCAAACTTCATCACAAGCCATCTAGAGTTCGTCGTGAGTCTCATCGTTCGCGCTGTGAgcT
GTGTCGCGGCTGGAGACCATCGCTAGGACTCGTTCAATGTGGCCAAGCAGCACTTGGCCGATGATCTCAGGTGAGTACTTCGTCACCATGTCGTGACGCG
CACGACGGCCCTTCTCCCTGGCCTCGCCCGGACGCGCCTTGACGCGCTGTAGTAGTTCCGTCAGGTGGCTGATGGACGGGTCTGCCCACTTATGCCCTCG
GAATGCCCCCTCTTGAATCTGCTCTCACTTCAaGTCAACACAAACgCCTAGAGGCCGCACAGATAACAGCGACTCACCTCCACAAGGCCATCGATCCGCA
GTGGGTACGAGTTGTCTTCAGTCATGTACTCGGTCGTTCCACTCCAGAACGTCGAGATTATCGGTAGTCCCATAGCCATCGCCTCGACATGAGGGCGACC
CCAGCCTTCACCACGTGATGGGAGCACGAACGCTGTTGCGGCCTTGTAAAGCGATGGCAACTGAGTCTGTGGTAATTGCGGTGGAAGAACATGAACTACA
GCGAGCTCTTCAAGTGTCTTCCCGAATTCTtCCTTCGCAAATGCAGCGATTGTGTCCATAAACTCCTGCGCCGTCTCCGTCTTCACATGGTACGCGTTCG
TGAGGATCACGAGCACGACGTCGTCGCTGCGTGAAAAGGCCTGGAAGTACGCCTTCAAGAGCACGCGCCAGCCTTTGCGTTCCTCCCACTTGAACACGGA
CAAAAAGACGGTTGTCGCTGGCGTCACTTGTTTCGACGTGATCGCACTCGCGAGATCATAAgCcTGCTCAACGTGGTCGGGGTTGAAGAAATGCACATCA
ACGGCCTCTGGTACGACATGCACGGCATCGGgCcGAACACCTCCGTCCACAAACACCTGCCTCTGGAACTTCGTGGGCACCCAGATCTCGTCCATTTTGT
TCATACGGTCCGCCCATCCGCTCGGCACTCGGTCCGTCTCGAACATCGTACGCCCCACTGCATACTGAGTGTTCTCTGGTGGGCACCGAGACGTCTTGTA
GTGAGCAGGGTACCATGCACCAGGCTCTGAGTGGCAAACCGCCAGTGCAaTCTTGCTCTTCTTCAACCGCCAGTGGAAGTCGCGGTCTTCGATCCAGTGC
T