Description :
From Genome Similarity Track
Location :
Scaffold_691:17586- 22541
Sequence
4955 bases(100 bases per row)
GCTGTATTACGCTTCAGACAAACAAGATGCGACAAATGATGGGCGTCTTCCCCGAAGTGCTAATGGTGGATTCAACACACGGTAGGTGGTATTTGCATGA
AGCCAAGAAGATAGAGGTTGTTAGCGTTTCCATCGACGAACCCCGCGTGGGAAAAAAAATGCTGTGATCGTGGTAAGACTGTGTTGTGCCCAAATTAATC
GAACCATTGCGCTCTTAATTAATGTGGATGTGCCTTAGGTTGACAAGGACCTTACAGAGATTGGTGTGCTACAGAGCGCATTTCCAGACGCGCGAATTTC
GTTATGTCGCTTTCATGTTTACAAGGCTCGTCAAGAACGGCTGAGAGAGTATCAGTATGGTAGCGACGTGCATGAGTCCGTCAAAGGAATTTTCAGATTG
CTTGCCGGTGCACGATTAGCAGCCGACTACGACAACGCTCGCAACTTCATGATATCCGCTCTACCTGTGCGCGAATCCAGTCCTTTCTTGGAGTACTTTG
ATGGGAATTGGGATAATTGCAGTGATAAATGGGTCAACTGCAAGCGTGCAAACATGCCTCACCTTGGCAACAATACAAACAATCGACTTGAGTCGGCGTG
GGGGAAAATCAAGCCGCATTTGACGAAGACAACCCCGTTAGATCAAAGCATTCAAATAGTTGTGGGATGCCAAGCGATAAAGGAGGAGGAATTTGACATG
CGCATTAACGTACGTAATCGGCGGTCGTGACAAAAGTGGTTACAGGAATGATTTACTTCTCATGCTGGACAGGATATCCGAATCAAGATATATCAAGAAT
ACGACGGGGAGATGTCGAGTCTTCTAGCGTGTGCTTCGGTGTATGCCGCACAGCTAGTGCATCCAGAGTATTCATTTGCCATTGCGGTGCGTGTCAACTC
GCAGATTGTAACAAAACAATTAATTGTTTTGCATTGTTCTCATAACGTGCGTAAATATAAGAAATGTGAAACACTTACTTGTCTAACGTCTTGAAGATGT
GCTCAACAACGTATCTAGAAATTTGAGGCGTCGATCAGGTTGTAGCGAGTAATGACAGCTAGAACGACCATATCACTTTAGTCTCCGCACCTTACCAACC
GAGCCAATTCAGACACATGTAACGTACCAATGACAACCATACGTCGGGTATAAATCCAACCATTTACTCAGTGTGCACATACTTAACCTGCTTCAATGAG
CGAACGGGCTAGAAGCATGTTATTTTATTTTTTCTATCGAGTCTTTTGCAACGCTTTGGCTACAGCTCGTCCAGTAGCTCGCGTTGAATTGTTCGTGGAC
TATCATCTGACGCAACTGGGAGGAAATGAACCACCACGTTTTGCTGGAGGTAATTAGGCAGCCCCCATTTAAATATTACGGAACTCAATATATAGCATAT
ACGTATTATTGTGCACGTCGCTGCTAAATCCTTGCCGCCTCGTATGGTACATTACATTTAATGATTGTAGATACAATGCGATCTTGAATGAACCGAACTT
GAACCGCGGTTCTGAGAAATACTTAGAACCCCCAAGACTCAGGAACTGGGTTCCTGGTTCGCAACCACTCCCGTTTAAGTATATAAAACCGCAACTTAAA
CGGGAGCACTTCTCTGGATATTCGTCGCTGGTTCACTTTGTCCAGTTTTAATTGGATAAAAATGTCAGCCTGTTGTAAATGCTGAAGTGTGAAGGCGTAT
TTCATCCAATAGCCTGCCGCATGGTTCATCCCACCAAAAGCCTCCTCTGTGAAATCTGAACCACAGGGTTGCAGTTTTAGGTTGTTGGTTCGCGAAAATC
ACGAAACGCCACCGCAAACCCAGTATATCAGTATTACCGAGTCGAATCATGCTTGCCTAAACTAGGAGAACTACCCCGGGGTCAGTAACTGGTTCCACAC
CGGTAAGTTCATTGTCATCGAATACTTATATACGCAGGCGCTTGGCATACTTCATAACGCGAAATACAAAACATTACTTGGTACAAAGCCGCGCGTgcgc
acggaacagctctggattttattTGGGACTGTTCGGAGTTGTCTCCTGGGTCGCGGTTGTTTAGAGTCCAAGCCTTGGACAATGGTCCACGCAGCTATTT
TACATCTTGATGTGCGACGAGCCGGCATGTCGCTCAAAGGCAGATAAAATTCAAAATGTTACTCCAACATCCTCAGCAAATCAGTTGCCACATGTACAAC
AGTATGCTTGTATATTTGGTAATGTTCAAACAAAGCGGTATGTTTTTTTAATCTTCAACGGATGGGTCAACCGCCACCACTAAAATAAATATCAGACAAT
CGAAAATAAGAGGAATATTAACCACTTTATCTGAAGATATTGAATCGGTTTTGACAAGGTATTGAGAATGCAAGGATTCCAACCTCATTCCAATCTCGGG
TAggactctggatataaaatccagataACTACAAAGTGACCTATCAAAAATACTGACAACTGAATTCTGAGCTAACTTTCAAACGTGGACTCTGAACGGG
CGAGAGGGATCTCCACGAGGAATAAGTATGAGTGTACCTATGCGAATGTGAATTGGAAAATCTTGAGTTCCCAAGTTATCTAGCGATATACAAAACGATG
AGACCGATTGAAAAGCAATGTTCAAAGTGACGAACACAGCACAAACCGTACACGTGCTCAAAACGGAGTCACTTAAAAAGCAAAATGGGTACCGTGACGC
CAGTATTGTTCATCACCTCGTGGGTGGACAATAACAAAGTATCAGCACTTAGCAAAGTGAGACACATGTCATTCCACTCAAGTTGTAGCAGTGATTGTGA
TAATAATTTACATGGCATTACGAAAAGCAGGGCTGATAGTGATTGCATAAGTACAAATTGCTTATTTTGTACCACAAGCAATACCACGGGTCAATCAATT
TGCTCCTGAGAACTAATATTCATCATCTAGTTTTTTCATACGCTGTATCTTGCTGGATGGTAAGAAAAGCATATCCTAGATTAGCCTAGTTTTAACCGAC
AATAATGTGGAACACATATTTGACCAGTGGCTCCAGCAACGTGCCCTCTTCAGGAGATGTTGCTTTGAGCGCAGAAGACCGATCAATGGCACTGTTCGCC
ACgagctctgctggtgctccAAAAGCCAGTGGTAGAGCCGCGAACTCTGCTGGTACTCCAAAAGCCAGTGGTAGGGCTGCGAGCTCTGCTGGTACATCAA
GCGAGGGCGATAGTATCGCGAATTCTGCTGTGTTAGCTGGGAACACCAATCGCACGGTGTCGCGCCGTGAAGATACACGCCTGTTTCCTACGACGAGAAC
AACCTTAGCAACTCTCGCGAATCCTCTGGCCACTGATGAATTTGTGAAGAAACGGCAACGAGTCTACTCCGCGACACTGCAGGCTCGTCGATGAATGCTA
GAACATGCTAGCGAGGTAGCACAAGTCCGACTTGCAGCCCGGCTTGAAGAGTACGGACTGCGGCTGCCATCAGCCGATTCACACAGTGCCACGACTACTG
GTGACCGCGGTGTTGGAGTTGatgtggagaagcagcgcgtaTTTAGTGAGTTCCTTCGCCGGTCCGGTATGCATCTACCCGAATTTGTTCGGCTTCTGCG
CGGGGGGTCGGATTTGGATCCTCGTCCGAATAAGGCCCTGGAAATCCCAAGTCATCAACCCGGGTGGTCCTCATACAAGTATCGATCAGCGTGGGAGGCT
GTGATACGTCATGTAGTTATTCCAGAATGGGAACATGACTTTTGTACCTCCTACCAACCACGCATCAGCTTCAGTGGCAATGCAATCGATTTTAAAAAGC
ATTCGCAAAGGTCAGGACCGTAACCAGTATCTCGTTCTCGACTTGGAATTACTGAACATCCTGTCAGGAATCACTTGTAATTCATTTGGAGCAGCACCGA
AGGGCTCTGCGCCGCTTTTGGAGGATGCCCGGATGATTCGCGATTTACCATACCCGGCTGGGCATTCCGTTAATGACAACTCCGTCGACGATGGATCGGC
CATCATTCAGTACGATGGACCACACGCGTTGACACGTCGAGTTCTAGATGTTGAGTCTCAATCTCCTGGTCGCACAAAACTGCTATCTGGGGACGTAAAT
GGAGCATTTCGCAATGGGCCTATTAATGCTGACCATGTTGGACGGTTTGGGGGGTAATTCGTGAGCTGAACATCCTCGTGATTGATCTTGCCTGCCCTTT
CGGACGGACACTTTCACCGGTGAAGTATTggctcgctggtggtgcgATCGCGCACCTGTACTCCACAGCAAAACCCAGCTGGGCGGCACGACCTGCTCGC
GCAGTTCAGCCGTTTGATGCAAAGAATTGGTGTGACGACCATAACGCCATCGAAGCAGACATTGGCACGCGACGTTTTGAGGCGGATCTTGCGCTACGCG
AGGCGATGATCATGATCCTAGGCCCTGACGCAATTAGTGAAGACAAATTCACAACTTGGGCAACTACAGGTAGGGCACTCGGTCTACATTGGAATATTCC
GTTATCCTACGTGGCGATGCCACCAGAGAAAATTGCGAAAGCCCTCTTGCGAGTTGAGGGCATGCTGGCCACTAAACACACGTCAAAGTCCAACCTGGAA
AAACTTCTCGGTAGTCTGCGTCACGTGGTGACTTGTGTCAGGTCAGCGGCGCCGCTCTTCCAACGGCTTGCATCCTTGTGTCGTTCGATTCGCCGGTTCA
GTCGAGCCCCACTATCCAACGGTGCTCGAGACGATTTGCTGTGGTTTAGACCGATCCTAAACACGGCAAACCTCAACTGGATGTCACGATTTGCGCAATC
GCAATCACCTGATATTACCGTATATATGGACGCTAGCGATGTTGGACTGTGTGCTCTTTGTCCGTCACGAAAAGAGTACATTCAGGTTGCCTTTGATGCA
GAAGAGCTTGACCAAATCGCCATTTTCCGTAATGAGGGAGAAGGCGACTGCGGCA