Description :
From Genome Similarity Track
Location :
Scaffold_12:175858- 177347
Transcript NameFunction/comments
g4942.t1hypothetical protein

Sequence
1489 bases(100 bases per row)
GCACCGCAACGCACTAAGTTTAATGAATATGTGAAATGCGTGTCCACATATACCGGATACCTGTAGTAGCGTTGGTGCACGGAGGTCGAATTGGTGCAAG
ATTGATTGTGGTTATTGTGTTGTGGGTTCTGCTCGAAATTTCCATGCGAGAGTGAGAATCGTCAAACCGTCGGTGAAATGAATGGTTACCCAAAACACAT
GTGTGGAGCGAGGTAAATGACTTGAGTTTTGTATCGGTGGTGACTTCACAATAATAGTGTTTCATACAAGGATTGGTTTTCAGAAAATCATACTGCAACC
AATACACTAGGGGAAAGCCGCACGAGCTAGGCATGGTGCGTGTTAAATATGGAAATGGGTGAATTGGGATATTGTTGGTCGTGAACAAAGGTCTCCACAG
TTTCAGCCATCAGTAGTAAAATGTCAAGATACTTATTACGGGGCCACTTGCATATTTACGGGAGCCTAGCTTTGCCAGTAAAATACTACAGTTATTATTG
TTAATTTCCCCCCGAGTCCTGCACGAATCGATACCGCGTTGTTGGAGCAGAGCAGTAAGAAGAAGAAAAACTCTCTTAATCGCTTCAGTCTTGATGTATG
ATGCGCCGTAACACCAAAATCTTTTATTTCATGCGAGAAAAAGTCGCAAACCTGAATAAAAGTCATTTTGCTCTGCTTGTCTTGTTAAAATGTTGCATCA
TTATGAACTGAGCACTGTCGCACGGGTAAACAACGATTACTCGAGTAGTTAATGAATCTACAAAGAATCTAAACGCAACCGGATGGCCCTGTGGAATCCC
TTGAGCATGCAGGGATGGTACTATTAGTACATGTAAAACACGCCGTTCCATCGGGCACCGCAAATTGAGCTTGTCGCTGCTTCGGAAGTACTTAACGTAG
CGTGTCATACGCTGCCTGCCATTACTCCTCCACTACATTTTTGTCGTTTTCACCATTCCTCATCCATTCTCGAATTTGCCAGCAGCCCCTGCGAACTTCA
GCTCCAATTGCCAACTTCCGCGTCCCACCTACAATATCCAGACTGATGCCGATCTCGCGAATCTTGACGACCCTGCTCCTTGCCTCTTTGGTCAACTTCG
GCTCCTCACTGTACGTCCAATTCCAGTACGGCGGCAAGTGGGTTAACGTTGGGAATCAAGACCTCAACGCTGTCGTCTACAGCGATGCATACGCCAACTT
CAACCAAGTGGGCGGAAGCTATCAGAGCTCGGGGTCTGGGTGGACAAGCGGCGTTATTTGCAGTAACTACGACGATGGGTCCTACCCTGCCGCAGATGTG
ACGTTCACCGTCACAGGACTAGCTTCATACGGCCAGGACGACGACCTCAGGATATCGGGCTGGGACTTCCGCGATTTGTTCGTCCAAACGATGTGGCAAG
GCGTCCAGCAGATCACCAATCCGACGGGTTGGTCCGTGTGCTCCCCAAAGCTTTCGTCGCCGGGCTGTGGGGGAATGGCTTGTGCCAGA