Description :
From Genome Similarity Track
Location :
Scaffold_308:17585- 23149
Transcript NameFunction/comments
Phymu_g8389hypothetical protein PHYSODRAFT_472680

Sequence
5564 bases(100 bases per row)
GCTCTCAGTTATGTCTGTCGACGCTACAATTCGCCATATCTTCAGCTACGACGGGAGTTCCGGCGATTCTCCGCCTCTGCAGCTTGCAGATGAGACCACG
CTGGTGTATGTGAGCGGCCACACGCTCCACTTCACGTCCACTACAGCCCAAACGCAGCACTTCCTGCTCCGTCCTCAACCTCGCAAGCTCGTAGCGTTCG
ACTTCAACTGGAAGACGTTGACATTCGCCATCGCCGCTCGAGAACCGGAAGCCACAATCTCCTTGTATTCGTATCCGgacaagaagcccaaggctCAATT
GGAGCTGAAAAACAATATCTTGGAGTATTCTTTAGTCAAGTTTTCCCGTTGTGGGCGTCACCTATTGAGTCTTCGTCCGTCACTTGGCAAAGATGAGGAG
AAAACGTCGATACTTTGTGTCTGGGATTTAGAGACTTTAACTCCTGTCCCTGGATGCGAAGACTCTACTGTTCGAGGGAACACACGCTTCGCGTCATTTG
ATCCAGTTAACGTACATCAGTTCATCGTGGGGGGTGACAACGGCCTTCAAGTCTGGAAAATCTACTCAGGTAGAACGGCAGCCTCGAGTCTACTTCGAGC
GGAGACGGTAGTACTCCCTGCTCTTTCAAAAGATGACAATTCAGTAGATGTAGAGTGGGAAGAGAAGCGGAAGCAGTTCTACTGCCACGCGTGGCTCCCA
CACAGTCGCTGTCTCGTTGCGAATTTAGCGGGTGACCTGCTTCTACTGGATGTGAGTGAAGTGAAGATCCTGCAGCATATCCAGACTGTAGCGAGACCCG
ATCGTTGCCATGTTGCGGGGCTTGTGGTAACAGCAGAGACGGTCGTTGTGGCGTACTCTGACGGTGCTTTATCGTGGCTTCAGACCGACAATTGGGAGGT
GTTGAATACAAGCGTTCTACCTGGAGGACCTACAATTGTGACGGTCATGACTCCGACTCCAACGTACGCGAAAGCTTACGTGGGCACTCGCAATGGCAAG
ATCTTCGAGGTTCGTACGAGTGTTCTAcaagatgatgaagacgacgtggagaacgaagaagacgaatCTACTCGTTCTACCAGGGAAGCCAGTGGCAATG
ACGAGTCCTCTTTGGTTCTACCGTGTGCGAGCTTCCCAACGGGCCCAGTGTGTGACAGTACCGTGATCACTCCATTCGGAGGGACATTTACTGCCGACGC
ATTGATAGCAACAGGTGGAATGAGTGGAATCCTTGCGCTTTGGAATCTTCGTGACTGTCGTCCAGTCGGAGAAGCCAACATCGCCGCCTTGTTCACTCAA
GAGCCGACTACTGAAACTACCAGTTCACGACCCGGTACTGCTGGTGgtacagctcctgctcctgctccaaaCGACCTCAGTGATGAACCAGCTCCCCCTC
CAATTGTAATAACTGCTCTAGCATCACGCCCAGCAGATCCTGTAGTGATGATTGGTGACCATCAAGGAAGACTCCGGTCTCTCTGTATCTCGAAAATTGT
GGGTAGAGGGGGGAAGATGGAGATTCTACCGCAACATTCAGCCCAATTACTGCCAGTTGATGCGCCGCTAGACCTTTTGGCAGTCCACTCTACCCAAACA
GTGCTGATGGCTTCATCTACTCATAGTGGAGTGGTGTTCTTGCTCTCTATGGACCATGAGAAAAGATTCCCCGTTCTAGCCTTTTTCACACTACGTGAGC
CAACGGAACGGGTAGTGGACATTCAATGGAATGTCGGTGGTGGTAGTACGAGTAGTTCACTTACGCTTAcgtgcttctcctcgagtGGATTGTTCTACAA
CGCCCGGTATCAAGCCCCGCCCCCAGAAGATATCTCCATCGGTAGTGCAGCCGCTGGTCGTCGAGATGCTTCGCCTCGAGGCGCGTTGCTCGTTCTCCCC
AAGGTCGTCGCTTTCGGAGAATCCGTTCTACCTATGTGCGCGAAACTACGTTTCCTCGCTGCTCCTTCGAGCAACATGATGGTCGCTACGTCTCCAGGTC
GGCCAGAGCTCACACTACTAAAATATCGAGAAGTAGTGCGCGAATCCATGGAGGAAATCCGGATTTTATCCAAAATTCTGACTGAAAAAGCTCACGCTCG
TGGCGTCTCAGCTGTCACTGTCTTCCCTCGAGTTCTGGACGGTGGCGTCGAGCTACTCGTCACTGGTGGGATGGATGGCACCGTCACGCTTTGGACTCTT
GCAGCAGTAAACGGTCGACGTCAAGTCAAACTGACAAATGACGTAGACAAGGAGGAAAAAGAGGCTTCAGGATCTGACGAACTTGAGGAGATGCAAGCta
ccaagaagcgcacgctGGTGATGCACAGCGGCCCAGTGACGACGTTAAAGTTCGTCCTTACTAAAGGGGGATTTCCTTCGGAGAACGGCAGCTCTGCGAA
CATCCAGTTGGTTTCTACAGGAGCGGACGGTTGTGTCTTTCTACTGGACGTGCGTTTGTCTGGCGAACTACTAGGAGAAGCGATGGGGTTAAGTCGTTCG
CACAGCCAAGAACCGACCATGAATCCTCTCTACATGAATGTGGTGTCAAccgccaagtacgacgacgTTTTCCAACCGGAACGGGAAGACGAACGCACGC
CGTTTCTGGATGCTCGAGCACGTGCAGAAGCTGTAGCAGCCAGGGACCGCTTCGATCGAGGCAAAGATGGTACTCGTGTGAAGCTTCGGGAGCTTGAAGG
GCGACTGAAAGTCATCCTTGCTGAGAATGAACGACTAACCGAGAGCGACCAGCTCCCCAGGGAAGAATTCGTGCTGAATGTGGCCTGGAGAGACAATTTG
TTAGCTCAACACGCTGCGAACGCTCAGCGTGTACGCGAAGGGATCGCACGCGACCTGGCCCGAATGGCAATTGTCCGAGAACGGATGAAACGCGAGTTCT
GGGACGTCTCGGAAGTCCCTGGAGTGCGTCTAATCGCTCTCTCCCCGCCTGCTacagcgtctccagttccAACTCAGTCGACAGCAGGGCCAACGCCTTT
ATTCGTGAACAATTTCCCCCTGGGGCGCCAATCTACGGCTGAACAGAAGCTCGCCAAGCAGATCAATACGCTTCGTCTAGTGGAATTCgcgcaccaccag
caagaAGATAAAGAGGGACAAGCTTGCGAGTCCAGAGCGAGGTTTCAAGACACAGTTCCGAGCGATTTACAGTGGGTTTTAGACGCTGGGTCGTTGCACC
CCAAGCTTCAAGGCTCTGCTACGGAGGCTTCACCTTCTTTTGACATCTCGGAGCACGTGAAGCTGCCCAGTTTCCACTTTGTGTATCACCCTGCAGCTGT
CCGGACCCAAAAGCAAGCTCGAGTGCAGATGCATTTGCTTGGATGTTATGTTCGATCCATCCAGAGCGCGTTTAATGGCGAGTTCCAGGACTTAGTACgg
cagaaggagaacacgATGGAGCAAATTGACGCTAAAAACGCTCGTATTGTGGAGATTACAAGCGAATTAAACGCTGGAGGCACTGGAGACCTGTTTAAAC
CGCAATGGGCGCCGGAGGAAAAAGCCGACTCGATCTTACAAGTGACTTTAGAAGAAATGACCCAGAAACCTTACGAGACGTCGGAACGACGCAAACAACG
CGAgaaagaagcgctggaagctgctgaacggGAAAAAGCCCGTAAGAAGGACGACGTTGGCGGTCGCGCCTTGATGGACATGATGGACGGCACTCTCGAA
GTGAAAAAGGACCCTCTGGCCGCCCAGGAGCTCGTGAAAGAGGCGTGGATGTTGACAATTCCTCCTGAAGAGATGACAGCGGAACAGAAGAAGCTTGTGG
CCCAGTTCGAAGCCGCACAAGCCAAattcgaagaagaacgggaaAAATACCGCAAAAGTctggacttggagctgcgaAAGACTCGAGGCGAAGTCGTTGA
TCTCTGTCGAGCGTTTGATGAAAAGTTGAAGGCTCTACGGGAGCGATATATGGCCACTCGTCGTGCTGTCTTGGCTCAAGAACTGTACGAACTTCGCTTA
GGtgaggagcttctggctcGTGAACAACTCGGACTTGAAACGCAACgactggaagaggaagtacAGACGATGAACGACAGTGAAAGTCACGCTCAAGCTG
AAAGCGACCGCTTTGCAGCGCAACTTGAAGCCTGTCGGGAGGATCTACATCGAGCGACTGAAGAGGACAAACTTCTGGACAAGAGCTTCGTCCGGGAGCT
TGAAGAAACGCTGCAAAGCGCAGGCGGAGGAACGCCCAGTGCAAGTACCAGCCAACTCGAGTCGCCGGAATTCATCAAGATGCTTCTTGAGTTGTATCGG
AAGCGTAAAGCTGACGACTTGGTGCGAGACGGAGCGTCAGGCCATGATACATTCAAGCGTGCTGGTTCCAACGGagtcactgctgctcgagccAAAAGTA
ACGCCAAACAGCGTCTGCTAGCAGAGAGTAAAGGCGAAGGAGGGTCTTCTCGTAGTCTATTGACGCCAACGTCCAGTAAGAACAACATCCCCGCGTCTGA
GATCAACTTGGACCCATTCCAGCAGCTGGATAACATCCACCGGGATCATTCAAGACGCGGAAATCTCACGTCCGGAAGCCAATCGTTCGCTGTAGCCCCT
TTGGACTATGTAACAGACCGACCGGAGGGAGTTCTCATTGAAGACCGTATCTGGCGAGCGTTGAACGCTCTTCGAGCCAAGAAAATCCTCGCAGAACATG
CCGTGCGTGAAAAATCTGAGATTTTCGCTCTGGCAAAGACCGTGAGCGACGAATTACGCGCTAAATTGTCAGAGCTGCAACGTGAGCGTAGAAAGCAACA
ACTGGAGCGAGAATCGTTAAGTCAACGGCGGACGGAGCTGACTGAGAGCGCCCCGTTGCTGGTTCGGATCAAACAGGGCCAAGATGAGACCCCCGTGggt
ggaggaggcgacgACGCTCTGCTGGTTGCTCGAACCAGTGTAGAAGCTCTAAATGACGTGATTCAACTGCACGGAAAAGATCAGGTCGGTATACTTGGTC
GGATCAAAGACTTCCGCAAAAATATCAACGTTATGGAGTGGGAGCACGCTCTACTGGAGCTCCAAGCTCGGGATATGGACGAACGGTACACTGACATTCA
GTTGCTTCGGGTCACGAAGGATCTGCAAGAGCTTTTCCATACTGGAGACACGTCCCACAAACAGAAGCGTGAAGCGGCCATGCTGGAAGCGAAGCTGGCG
CATTTAGGACGTCACCACCAGGCCAGTTTACTCAAGCTTGAAAGAACGGGGTCGCACCTGGAACGGCAACTGAAGGACCGACAACGAGAGAACcggaact
tccagcagcaagtggcgCAACTCGAGACTCAAGTGCAGATCCGCGAAGACATTTTAGCTAGTCGAGCAAGTGCAGCCATGCGCCAACAGGCAGGAGGGAC
GAGAGGTGATGCTACGAGACTGAAAGCAATTGCAGTGAGGCGGAAACTGGTGGATTTGGCGAAAGCTCAgacggacgagatcgagtATCTTCGTCTTGAA
CTCGATAAGATGCGACGTCGCACGTTCCCCAGCTTCGCACAAGCCCATGCTCGCGACTATCATG