Description :
From Genome Similarity Track
Location :
Scaffold_220:1758- 5047
Transcript NameFunction/comments
Phyta_totarag5786conserved hypothetical protein

Sequence
3289 bases(100 bases per row)
CAAAACGTCACTGCTTCTTAACGACCGAACCAGTTCGACGCTGCAATCCCATCTGGTGGTCGAGTTTCAGCGGACCCCGTGAAGTTCACGGTGAATCCCC
TCACTTGCGTTCGTGGGCGTACCACACTGGTGGGTGGCTGTCGGTAGCACGGCTTGCTGAGCAACATCCTGCACCGGATAACACAGAAGACGTCTACATC
CCCACTCCAAAAGCTCCTCCGCCGCGGAACGAGAAGCTGGCCGGCGTGCCAAGACGCCGTCTCCGTTGTCCTAAACTGAGCGAAcaatgtattaatacat
gtacagtatgGGGGCCGAGGCAGGCATCAAAGCCTTGGAGACTTCACTTCAACCAGGCGCCCTGCCATGGAGCGCCCGTTGTAAACTGACGGCTTGTCTT
ACCGGCCCATCTCCGATGCTGTCGCTCAACAATTTGTTGAGCGCGGCGGCCGGGATCAGCTTGGCGACTTGTCCACGCACGGCAGCACCGTTGGGTGCCG
ACGATAATGTCgtggccaagtgcaagccGGTGCAGCGGATCTTCTCTGGGGATAAATGACTGCCGTGTCGAACAGAGGCCGGTTTGTAACCCACATTATC
AATTGATCACCTCCGTCGGACTCCTGTATACATGTTCATGCATTATTATGCAGGATTCTGGcgcttacatgtacagtattatCATCTTGTTCGCGTGGCG
GCACCCCATGAATTCCCTCCATGATTCGCTCGTGGTAGATTTGCTATGTCGGTGAGCTCATGCAGTTATAAGTAAGTTACAactttgtacatgtagcgtt
ATCCACGAACTTTTTACGGAGATTGTGTTAAGATAGTCGAAAATGTGACTGGCATACAAACTCGAGTAGAGCAGCTGACTCTTCATTACTTGAAATTAGT
ATACTGGGAAAACATGGCAAAAACTAGCGGAGACCGTCGCCGAATCGGAATGGGAACTAAAAACCTGGTGAAAATCTATCCAAGAGTTCACTTGCGCGTC
CGCATTCTGCTCGCTACATCCGGTTCGCGGCCGGCCTGCCCATGCTCGTGTATCACTGAAGTGATCGTCAAGCAAGCAAGGCGTCAAACCCTCGCGCCCG
CCTGTCATCACCCTCGGTCGGTCAGCACCGCGTGTTCGTGCCGGAGCCTTTTCTGCATTGTCGGATCACCCGGGGAAGCCAAACTGCTTCCTGGCCAAGC
ATGAGTAGCGGCCACACGTCTGGAAGACGCTCCAACAGCTCGGacagcgcctccaccgtTGCAGGACCCGTGAGTGTTGCAGGCACCACCAACGGCTACG
GATTCCGCAGTGCAGGCGGCGATGCGCTCTCCATTGAGATGCAGTTCTTGAACCCGCGGAGACGCTTCCCGCTCGCGGACGAGTACTTGCCAGCTGTGCA
TGTCACGGATGAACAGGTGGAAGATCTTCGCGAAACATGCGAGCAACTCATAGCCGACACGCTTGAGCTCACCAGCATGTTCGCCTGGgaggacagcaac
aacaacgaccTCGTCGGAGAGCACCGTGAACAGTGGAAGGTGCACTACAAGCGCCCGCATGTGACGCTGTACCGCAAGAAGCGCGGCAAGGACGCGACGG
ATGCCACCAACGGCGGCTTACGGCACTACGTGGTGAGCGGCCAGATCCATGACATGACACTAGAGGACGTCAAATATGGACTCTACTGTGACGCTACGCT
GGACGAGCGCGCCGTCATGACGGACTTGTACCGCGAACTCTTCCTGGATGCAGCGGTGCTGCGCAGCTTCGAAACACAGACACCAGTGGACCCGTTCCAC
TTCTTTGGTATCAAGTGGTTGGCTCACTTGAGCCCAGCCGACAAGTTCATATCGCCTCGCGACTTTGCCTTCGTGGAATACTCACAACGTGTGGTCGGTC
CCAAGGGTGAGCCGTTGCTTGTCAAGGTGCAGCAATCACTAGGTCCAGAGCATGTCGACGCCATGAATCGCCGCGAGTTCGACCTGGTGCGTGCTCAGAt
gagctgcaccaccatGTACCGCCACGACAAGCGTGCCAACAACGTTCAGGTCATCGCACGTGGCTACCTAGACCCATGCGGAAGCGCACCAGAAATTATG
ACGCGGTCGTTCTTGACACGCTTGGCGCCTACTCTTGTCGAGGTGGAGCACAGCGCTGACGTCAAGTACATTATGCGCCACGGTCTTGTGCTACCAAAGG
AGCAGTTTTTCGCCCGACGGAACGCGCTGAAGGCTCACGGTCTCCACTGTCTGCAGTGCACAGCGTGCGGTAAGCGCTTCGGTCGCCTGAAGCGCCACCT
GACTCAGTGCCGTGCGTGCGGTGAAGCTGCTTGTGGTCGCTGTCTCATGACGTATACGTTGTGTCTTCCTCACCACGAGTGCCGCAGTGCAGAACATCCG
GGCGCTGTGATCCCGGGGCGCTTCTGCCTGCGTTGCTTGTACTCAGGCCGTCTTGACCGCAGAGGCCAGCGTATGGACGACTTCCTGCTTGGTGGAACGA
TGGCCCCTTCTGGTCCGTCCACCACTGTTCCGActgtcgacgatgacgacgaggttgacgatgacgatgagtCTGTCGTGGAATTCGCGATGCTCGGCGA
TGGTCCTGGAGCAATGCATGCCGCCATTTCAGAAGCGCAGCGCTTGCAGCGCCTCAAGCAGCGCTATTTGGAAAATGAGAGGCGCAAATACCTCAGTAGG
ACCCACCAGCAGTCACCGGTACAGCGTTTTGTCATggaccaacagcagcagatgcaccACTACGAGCAATCCACGCGTAGCATCCAACGCCCACCTATTA
CACGGAGGAGCAGCCAACCAACGATGAATGGCTCCGTGGGATCCTCTTCTATCTCGTCGGCGTACAGCTCGCTGTCTATGTCTAGCTCCACGTATTcttc
agcagaagctgcggtGGCCGCCACGGCTGCTTTGCAAGCCACGACAGGCTTTCACGAGATGGAGCACTCTATCGGCGAGCAGGAAGCGTTGCTGCGGTCG
CTACAGAATGAGTACGCCAAGATGAGTATGAACCAGCGCTCAAATTCAAACCCCGGTTTCAACGCGCAGCAGATGCGCGAAAACCGCTTGGCCGAATGGC
AGGCTGCCGAACGCATGGCGCTGCCGGCATCGACATCCAATCAGTATGACATCGATGACTAAGACATCAGCGCCGGAAGTAGTAAGATTTTACAGAAGTG
AGTGAGTGCAAACAGTATGTAGCTACTGTAGCTAGCGAGACCGATCCGGAAGTGCAGACGGCCTAATCTATAAATTTGGCGTTATCTGT