Description :
From Genome Similarity Track
Location :
Scaffold_239:17578- 19319
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_16178ABC transporter ABCF family

Sequence
1741 bases(100 bases per row)
GCGGTAAGGCCGCCAAGAAGGACGAGAAGGCCGAGTCGGTCCCGGTCGAGCGCACGCTGGCCGACAAGCTCGCGGACGACGGCATCATCGCCACCTGCGC
CATGAACGCGCGCTCGGTGCATGAGAACTTCAAGGACATCAACGTGCTCGACTTTTCGATCACGTACTTTGGCAAGGTGCTCATGGAGAGCTGCGACATC
TCGCTCAACTACGGCCGCCGGTATGCGCTCATCGGCCGCAACGGCTCGGGCAAGTCGACCTTCATGAACGTGCTCGGCGCGCGTGGCATCCCGATCCCGG
AATCGATTGATATCTACCACCTCAAGCACGAGATTGAGCCGTCCGACATGACGGCCCTCGAAGCCGTCATCACGGTCGACGAAGAGCGCACCAAGATCCA
GACCGAAGTCGACGAGCTCTCGGAGAAGATGCTCGACGAGGGCTTGCCGGACGACCAGGCCGAGAAGATCACGAACCGCCTCACCGACTTGTACGAGCGC
TTGGACGAGATGGACGCTGACTCGGCCGAGATCCGCGCCCGCAACATCCTCCGCGGTCTCACGTTCACGGACCAGATGATGCAGAAGAAGACGCGCGAGT
TTTCGGGTGGCTGGCGCATGCGTATCGCGCTCGCCCGTGCGCTCTTCATCCAGCCGACGCTCCTCCTCCTCGATGAGCCGACCAACCATCTCGATATGGA
GGCCGTCGTGTGGCTCGAGGACTACCTCTCCAAGTGGAAGAAGATTCTGCTTTTGATTTCGCACTCGCAAGAGTTCATGAACGGCGTGTGCACCAACATC
ATTGAGCTCACGCGCAAGAAGCTCGAGTACTACTCGGGTGACTACGACACGTACATCAAGACCAAGGAAGAGAAGGAAGAGAACCAGATGAAGAAGTACG
CCTGGGAGCAGGATCAGATCAAGCACATGAAGGACTACATTGCCCGCTTCGGTCACGGTTCCGCCAAGCTCGCCCGTCAGGCGCAGTCGAAGGAGAAGAC
GCTCGCCAAGATGGTGCGCGAAGGCCTCACCGAGAAGGTCGTCAAGGAGATGGAGGGCGACTTCAAGTTCCCCAACCCCGAGCGCCTCCCGCCGCCGGTG
CTCATGTTCCAGGAGCTTGCCTTTGGCTACCCGGACTGCCCTCTTTTGTACGAGGGTGTTGAGCTCGGTCTCGACATGGACTCGCGTGTCGCCCTTGTCG
GTGCCAACGGTTCGGGCAAGACGACGCTTCTCAACCTCATCACGGGCGACCTCACGCCGGTCAAGGGCAACATTCGCCCCCACTCGAAGCTCCGTGTCGC
CCGCTTCACGCAGCACTTCGTCGATGTCCTCGACTTGACGAGATCGCCGCTCGAGTACTTCCGCTCGCTCTTCCCGTCCAAGAGCGTCGACGATGTCCGC
TCGTACCTCGGCCGCTACGGTATCACGGGCGAAGTCCAGACGCAGATCATGGGCCAGCTCAGTGACGGCCAGAAGTCGCGCGTCGTGTTTGCGTTCATTG
CCCAGCAGAACGCGCACATGCTCCTCCTCGATGAACCGACGAACCACTTGGATATGGAGTCGATCGATGCGCTCGCGCGTGCCATCAACGCCTTCGAGGG
CGGCATGCTCCTCGTGTCGCACGACATGCGTCTCATCTCGCAGGTCGCCAAGGAAATTTGGCTCGTCGAAGACAAGAAGATCCGCGTCTATGAAGGCGAG
ATTTCCGACTTCAAGATGCGCGTCCGCAAGCAGCTCAAGCT