Description :
From Genome Similarity Track
Location :
Scaffold_33:175775- 182596
Sequence
6821 bases(100 bases per row)
TACCTATAAATATATTCAGCTTACAACTTACCTTAAATTGATCACTTCGCTCCCTGAGGCAAAAGGGGGGCCTGTGAACCGCCGTTCACTGGGAGTTTGT
AAGCTCTCGAAAGCCGATTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGGCACACTTGGTAGCACTTATAGTCAATCCACGGCAGCGCGAGTAGACTTGC
TGAACCTCTCTGAAACTTGTCGCCATAGATAGAAACGACTTCTCCCATCGGAACGACTCACAGCTCGAGTCGGTTCGGAAGATGGCTGACATGTTCGGGA
CGGAGGCCCTGCAGAGCCTAGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGTGTTAATGCGTTTGACGCTTACGAACAACGGCTCATCGCACATGTGCG
GGACACTTGCAGGATCCGGCGGCAGAAACAAATCCGCCACACCCGAAGCCAATACGGCCGAAAGTTAAGCTGTATGAAGGGAAGGCAGGTGAGAATCTTC
ACTTCTGGATTCGAGAGGTAGAGCTCACGATGGACCCGGCTCTGATCTAGACCGAGCGACTCCGTGCTGCTTTTGCGCTCTCCAATCTTAGCGGTCGCGC
TAAGAACTGGGTATACACGCGGGAGGTGACATCGCCGGGATGTTTCACATCCTGGGTTCAGCTCTGCGAGCAGCTCCGAGCCTCATTCCTCCGGCGAACT
ACTAGTACTGGCAGCGTTCCGCTTCCTATCATGCAAGCAAGGAAGGTGCGAGCTGCACGAGTACGCCTAGGCGATACGGGAGCTTACTGCGTCTAAAGTG
GGAAGACCACTCAGCGAACGCATCAAGGTGACTGTGTTCACGGCCTTCGAGAGGGCCAACGCGCACTCATCTGTTCCGGGTGCAGTCAAGCACGCTCGAA
GAGCGATTCAAATGGCCGTTCAAGAAAAGTACAGCCATTGCTAGGCGCGTACGCCGACCTCAGCGGGACCAGAAATTCTGGGTCGAATCCCGGTCGAGCA
AACCCCACCGGACCAGTTTCCATGGAGCACGGATCCGCCAAGCAGCGCGACACTCGCTGCTTTGTCTGCGGGAAGCTGGGCCACTTCAAACGTGACTTCC
CCGCGGAAAGACACCGCAGGCGTACGTTGCCCAAGCATGTCCTCATGGGTAGGTGGCAAACGACAGAACTCCGGGAACAGGCGAACGCCGGAGACAAATA
GGGGCGGGGCGCACTACTGAGGAAGATCTAAGTCTTCGTGAGGGGTGTGCGGGTGGCGAGCACCACGGGGACGTAGCCCCTAAAAGTCTTCACACTTTCG
AATCGGCGAAGCGTAGCCGCGGGCTTCTCGTAGTACACGGATTTGGACAGGGATGCGATCACCCCTTTAGCATATTGATCGATTCTGGGGCGTCGAAGAA
TTTCACACGACGCCGGACGGCGGCTCGTAATAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGTGACTGGCCGAC
GGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGCTTGAAGACTTTAACAGCCTTGATCAGATTACTGTGTTCGACATTGATCCCT
ACAATAGGGTCCAGGCCATGCCCTGGCTCGCGAAAGACGAGCCTTGGATCGACTGGCGAGGCAAGGCAATCAGTGTCAGCTGCCATGCGAAGTCAGACAT
AGAGTTAGTGAGTCATGTTCCCACTTCTGTCAGGACCCGGGGCACCCGTAAGGGCTGCCAAGGTACCGAAGCATCGTACGGATGCTTGGGAGCCGGCGAC
GTATATGACGACTCCGAGGACGCTTCAATGGTGGCGGAACTAGGCGGCGCTGACCCAGTGGGTAACGTTTGTCCACAGGCGGGCAACATAGCTCCATAGA
CAGCTGCAGCTGTCCCGAACGCTGGTAATATCGTGTACAAGGTGGGTATCCGAGTTCCACACACGATCGCACAGACCTTAACTGAAGAGGAAAATGTTGG
ATTCGCTTCCTGGGTGTGTAACATAGTACCACACAAGGCCTCGAGTGTCTCGGATGTCGGGACCATGACATCCTCAGACGTGGGTCACGAACTTTCCGCG
TCACGGTCGTCGTCGACGTCGATGATGATGCCGCCGAAAGTCGGATCTGAACTTCGTTCAGATTGACGTCGCTTCACGCGGCTCGGACTCCAGATCCCGG
GCTCCTCCGACAAGGCCAGCGGAACAGTGTTATCACATCTTCGATAGCCAGACCTGTTTACCCGTCGAGGCATATGGTGTACACTTGAAATCGTTGCCAG
AGGTTGTAGAGATACTAAACCTCGAGGAAATGACGGTCGAGTTTTTCCGGTAGGCTGGGGAGGTTGCCAGGATGGTGCTCATAAGACCGGATATCACTCG
GGAGGAGCTGAACTTCTTCTATGGCTTGAATGAGCACGTCCTTCTGGGAAGACCTGAGCAAGCAGCGTCAGACAAGCTTGGGTTCCGAGATTTTTAGGTA
CCCCAATGATCCGGCGTATTCTTTAGTGACGGAGTATGCGGACGTGGTGAGCAAACATCCACCGAGCTAACTCCCACCGGATCGAGGCGTACGGCGTGAG
ACCGATCTCGTGCCTGGCACAAAGTACTGTGTCATAAGACAACGGCCTCTTCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCGA
AGGCAGGTATGGTGCGGGAGTCGGAGTCCCCGCACTCGACACCAACTTTCTGCGTTCGGAAGCCGAACGGAAAGTCGCGTCTAGTTCACGCTTATAACAA
GTTGAACAACGCGACGGTGCCAGCCCAGACACTAATCCCACGAAAGGACGTGTTTATGAGCAACATGGCCGAAAGAGTTCCTACACTGCGCTGGATTTGG
TATCGGGATTCTACCAGATCCTGATGCGCGAGAGCGACATCCCGCTCAACGCGGTGAGCACTCCAAGCGGCATGCTTTGGGAGGAAGATCGTCATGCTTA
AGGGTTTATCTAACGCCTTGGAGACATTCAACCGCCTGGTGACGCAACTGTTCAGGCCATTGCGCGCCTTCATACAAACGTACTCCGACGACATCTGCGT
CTATAGCCGTGTAGAGGGAGGCAAAACGGACATGGAGGTGCATTTAAGCCACCTCCGCCGAGTGTTAGACCTGGTCCGAGCTAACAAGCGCTTTACCAAC
CTTAACAAGTGCATCTTCGCATCACGAGAGATCAAGGTTCTTGGCTGCTTCATCAACAACGTGGACGGTCGGGCTGACCCAGACAAGGTCCATGCCATTG
CAGCATGGCCAACGCTCCGATCTTAGACAGATCTTCGAAAGTGGGTGGGTTTGCTCACCTATCTTCACAAGTACAGCGCAGGGTACATGGACCTCATTAA
GCCCTTGTCGGGCCACCTTCATAAGGACGCCTACTGGCACTGGGAGCAAGAGCGCCAGGATGCCTTTGACGGCGTCAAGCCCAGCCTCCAAGAACACTAT
GTCCTGTCCCTGCCGGACGAGACGAGGACGTTCAGCGTCGTTTGTGATGCCTCCGACTATGCCATCGGTGGTGCATTGCTGCAGGCCGACATAGCTGGAC
ACGAACGACTCATCTCGTTCCAATCCAGGCAGCTCGATGCCGCCGAATGGAACTACCCTATCCACGACAAGGAGCTCATGGAAATGGAGTATGCCCTTGT
GAAGTTTCAGGTTCACCTTCTGAGCTCACGGCCCTTCGTGGTCTACACAGACCACGCATTCTTGAGGACGGCGACAAATTCGCCCTACCTTTACCAACCG
ATGGCGAGGTGGCTGGCCTTCTTCGCGGAGTACTATTTACGCTTTGAATACAAGCCGGGCAAGCTCGTGCTTGCGGAAGCCCTCTCTCGGCGTCCAGACT
ACGGGTTGGCCACTTCACCCGGGTGACAACCGATGTATTTGATCGGATACGCGTGGCGTATCGGGACGATGAAGCTGTCGCGCCTATCGTCAAGTTTCTA
GCAGCAGCAACGAACGTGAAGTTTGACTGGCTTTCGTCGCGACAGCGTTCCCGGCTCCACCGATATGAGTTGAAGGATGGTCTCCTCAATTACCAGGTGG
ATCCTAATAAACATCCACGGGTGGTCGTACACAACGACGAGGATCTATAGTTCGACATCCTTGCGAAAGCGCACGACGCACCCTCCAGTGGTCACTTGGG
TCGCGAGAAGACCTTCTTGTCGGTCGCTCAGGTCTTCTGATGGACCCACATGTACAAATGCGTCGCACGATACGTGAAGACATGTGAAACATGTCTGCGG
GTCTGCAGGGCACACTTCGGGCCCACTACAGAGCCTGCCCGTTCCGGCGGACAGTTGGAAGACGATGGGTCTTGACTTTATCTATTGGCTTCCCGCTGAC
GGACACGGTAACACTGGGATTTTGGTGCTCGTGTGTTGGCTAACGAAGATGATACATCTTGCTCCTGTACTCGTCACGGTCACAGGCGGGCCGATCGCAA
GGTTGTTCGTCGATGGCGTGTTCCGTTATCACAGTCAATTGTCTCGGATCGAGACCCGCGGTTCACGGCTCCGGTCTGGAAAACGCTGTTTCAATTACTG
GGAACTCGTCTGCAGTTGTCCACTGCTGACCATCTGCAGACAGACGGACAGAAAGAGCGCGTCAATCGAGGGCTCGAGGACAGTGTATTACGAACGTGAA
TGACGCAGCTTCCGGTTGTTACATTTGCGCTCAACAACGCGGTGCACACGTCCACAGGGCTCACGCCGTTCTACTTTAATAGCTTCCTCACCCAGTGTGC
CTCTCACTCTTCGAGGAGACACTGCATCCGCTTTTTTAAGTGGGGGAGAGGCTCGGAAAGCTCATTCTTCCCAGGATTCAGATGTGAGGCCGTTTTCGCT
GCTGGCCACGCTAAGCGGATACCACGCTAAGCGTGATGAGCAGGGTCCGCGATGACATGGCAGCGGCCCAGGACAGACAAAAGGCGTACTCTGACAAACA
TGGAAGAAGAAACTTAACTGTGTTTAAGATGCGTGAATTAGTGCTATTAGACACGAGGAATCTACGGCTTAGCGCTATCGGCAACAACAAGCTGAAACAC
CGATTTATTGGACCGTTCGCAGTCCTGGCCAGGCATGATGCGTCGTATACCATCGACCTGCCCAAGTAATGACGACGCACCCGACGCTCTCCGTTGGACG
ACTAAAGCAGTACCATGATCCGCAGGAGGTTGCTAACTCGCAGATCCACCTTGGTCCATCTCCTCGAAGAAATGTTCGACCACAGACACCGACGAGGACA
CCAGAGCAGGCTCCCAAGTCTCAGGCTGAACAGCAAGGCTGCGGTCGAGACCGTACGGCGGAGGTGCCCCCTACGAACGGTCCCCAGAGCCATACGCCGC
GTACGCCGAGTACATCGGGTACGCACCATACGCGTACGACTGGAAGTGCGCTGAAAGCGGGTTCGGACGTGACAACAGAGTCTCAACACGTCGGCGCATG
CGGAAGGCCTCGTCAAGATCTGACGAAGAGGCCCGGTGGTCCACTTGTAGATGCAGGCTCGAGCCTTCCGCTCCAACAGGTCTAGGCGGCCGGCAAGGCG
AGCTAGCATGCCCTGATTCCCGGTCTGGGTGGCAGCCCCAAGGCCAAGTGCAATCGCAAGCACGAGGACGCGCTGACGGAGGCGGTCAGCCTCAGAGCTC
TGCGTCGGGCCCGCAGGAGAAGAAAACGGACGAGAGTAGCATTCCGGGGGCGCCGAGCACTCGCACTTGTACGAGGGCACCTTCACTCCTTCTTGACTGG
AACGAAGCGGTCCACTACCACGTGGAGCGGATCCTCCAGGCGCAACGGCGTCGTGGTAAGCGACAGATCTTCGTAAAGTGAAGAGGTAATGGCCACTACG
AGAACTCGTGGGAGCCGATGGAGTGACGCCTGATAGACTGCCTGAAGACTGTCGAATCTGGGAACAGAAGCGGTGGCAGCTTCGTAAGTAGTCCAGGTCT
TCTTGCCTGAACGGGGTACGGACGTCGACGCCACTCCGTACCCGCGCTCATCATGAGCGCTAGAAGCCGCGCGCTTCAGAATATCCCTTGGTAGCATGCG
CTTGCTGGCCAAGTAGGCAAACCGGACACGAGATCACGCTGGTCCAGGATGCGGAACAGCAGCTGATCGTCATGGAGTTCCCGTTGCTCCGAGGATGGAT
ACTTGAGAGACTCCACGCAGGCCCAGAACATGTCATCACACGAGTTCCAGTTGGGACAGTTCTCGAATAGAACCCAGGGGTAAGCCACAGAGCGGGTAGA
GACCACCCCGGTTCTCGGGCTTCTTACGATAAGTCGTGAAGTCTTTTAAAGGAATTCGGTGCGGTGCGAGAAGTACGCACCGGGTCGCCTCCAAGTTGTC
GACGAACAACTGATCCTTGTGGACAAGGGTTTGTTCGTAAACGCTCTTAGAAGTGTGACCCCCAACAAGGCCACGTGGAGCGACGAGAATCGCCAGAGCC
TGGTCAGCCTGAGAGCTCTCCTCGGTAGGCCAATAAACTCATGCGTTGATGGCAGCTCCCTGGTTGACAGGTGCCACCCCCAAACCCTCACGCATGCGCC
GGGCAGCTTGGAAGTATTCCTGCCGATGGTCGATGTCGTTCGTGATCTCGCGAGGCGCATGGATAGCACCCTCCTCTTCCTCTTCACCCGAGGAGCCGAA
GAAGTTTCAATAGGAGTAACCAGTATTATTTTTCTCCCGGAGTGGAGACTTCGAAGCCGTGCGCTTTTAAAAGGGCTTGGCGTATTCGGCTTTGGTTGCC
TTAGCATGCGCAAGACCCTCG