Description :
From Genome Similarity Track
Location :
contig_12:175707- 177526
Transcript NameFunction/comments
g3753.t1hypothetical protein

Sequence
1819 bases(100 bases per row)
CCGGGACATGTGACACCAGCTTGGATACATGCGCAAATTATATGGCAGCACAGACCGTGCTTGCGGCTGCAAGGACATGAGCACGCTCTGCTCCGTGTGT
CCACGATCCAGCCGCCATTCGGCATGCCCTCGATCTGCATGCGGCGTGCGTTCACAGAGCGCACATTGTGAGCTACAAGCTTCTTTTCAGCTGCCGTGAG
CTGTAGAGGCTTGTGGTCGACCCTGTACATATCAGCTGCAACCGATCCGACTACACGAAAACGATGCACCAAAAAGCATCCCCGGCTATACAGCAGCCGG
TACAGGCTCGAGAATCGCTCAGAGGCGGTGGCCACGAAGCAGAACGAAACGTCGCGGTTCAGAAACGAGAGCCGGGCCCCGTTGATTTCGAAGCAGCTCG
CTGGGGGTAGCCGGGCCGCCGGGGCACTGAATCTTCAGAACTTTGTGGTACTGCTCCAGCGGGTTGTTAGTCGCTGCGTACCCTCTCGGCGTACGAAAAG
CTTGCCAGCGGTTGAACCGAACGTTGGTTATCCACATCTTCGTGATATGGTTGGTTAACTTACGCGCCGGAGTGCCCTGCCCGTAAGTCTGCCATTTCGT
AAGAACTCGATCTTTCGAATCCGAAAAATCCACCTCACTAGCGTAGTGCAAATCGTACAAGTCAGCAAATATAACAGCTGAATCGGCATGAGGAACTTTC
ATCGCTTGTGAGTATTTCCACATATTTTGCATGACGTGAAACCAGCACATTAGCACCACTGAGCGCGGCAATTCCGACACACACGCGTTGAATTGGGCCT
TGTCGGCATCCATCATCACAAATTGCGGTGTGAATTCAACACCGCATGTATCCATGCACACCCGTCGCAGGTAGCGGATGCACCAGCCGATGTCGATGGC
TCTCTTTTGCGCTGTGCAATAGAACACCAGCGGAAAAAAAATGGCCAGAACGATCGGAATATCTAAACGCAAACACGACGTAGCCGTTGATGAGCATGTT
GTGTGTACTATCTACGTACAGATCGTCGTGCTGTCCGGTCGGCTCTGCACAGCAACATAATCTCGGACGAGGCGTAAACAGGTCATGCCAACTCGCAGAG
GATAGGCCGAGGATCCATCACCGAGATGGGAATCCAGGTAACCTGATTCATCTGGTGTCGTCTGCGAGTCGCACAGAATCACCATCTCGGTGTCGGCGTG
TGACGCAACGTTGACCTGATCGTAGAGTCGACCATCGCACAGAGCAATTAGCGGTGCCATAGAGTCCTTGGGATTCGTGCGTCTCCAATTCTTGACGAAA
TCCGCCACCTGCGTGGATTTAGGCGCAGGACCAGCCATGGACTGCTCGTCGACAAGCGCACACAAGACGGTGTGCAGCCTTGCAGCAGTCGCTTTATCTC
CACCACTAAGGCTGCTGATAATATAGTATTTCATCCCCTGTGTGAATTGTCGCTCGACTGGCGTCGGAGGGTCGTTTATGTCCATCACATGATCGCCTTG
CTGGAATACCTCACACGCACTAGACGAAAGGCACAGCTTGAACTTGTAGCAGCAAGGACAGGGCGGAGGTGGCCCGGAAAAGCCAACGTTGAGACGTTTT
TGCTGCTTCTTGCAGCGCTCGGAGCGACAAGGAACCATCTGGGACCGCATTGTGTGCGAGCAGCGATGTAGATCGTAGTCACGGTCGAGTAAATGGTTGA
AAGTACATCCAACTTGAGTACTTTTATCGACAGCATGTGTAGGCATCGAGGTCCTGAACTCTTCCGAGGTGTCGGTGGTTGTAGCTCGCCAAATCCTTGT
CCATGGTGGACGTTGACGC