Description :
From Genome Similarity Track
Location :
Scaffold_19:175703- 178478
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007673Similar to DSPP: Dentin sialophosphoprotein (Homo sapiens)

Sequence
2775 bases(100 bases per row)
AGTGAGGATGAAGACTATGACACGGACAAGCGCAAGGTATCCAAGCGCCGCAGTCGTCGCCGAGGAAGCGACGACGATGGAGATGACAACGAGACGCCGC
GATCGTCTCGCCGCAATGACAAGAAACGTCGTGATGAGGCTGCGACCACGACGGCAGCTGAGACCTCCGTTACGTCGCCACGCAAGGGCAAAGAAAAGAA
GGACACAGGGACCAGCGGCTTGGAGAAGGGCGTGGCGAAACTCGAGGTACAAACCGAGAAGCCTGCGTCGCGGACCTCCGAAGTGATCTCGGACCACTTA
CCCTCCGACCAGGACAACAAGAGAACAGGGACGTATACAGCAACGACGACAAAGACCGAGACCGCAAGGGAGAGTGGCAGTGCACGCACAAAGAAAGACG
ACGAGAGCCGCTCCGAGTCAACCGTCGCGGCGCAAAAGGCGAAAACCAACCTGGGCAAGCAAATCGGTGAGAAAATGCGCTCGCTGCTCGGCGGTGGCAA
GAAGACCGATCGATCGCACAAGAGCTCGAGTGGCATCCTGAATGCGTGTCCTGGCACGACGCAGGGCGAAGAAGGCTGGTATGAGCACGGCGAGAACGAG
CGGTACTACTTCGTGCTCGTTGACGGCAAGTGGAGTTTGCTGTACGGCCCCATGACCGAAGACGACTTTGAGCTCTACTCCAACAAGGTACTGGTGATAT
GTGTTGCTGTTGTGATTAATTGTGTGATATGGCAATCTCACTCCCTTCTTCATTCTCTGATATATTTGGTAGGTGTTGGAGCAAAATCGCATGATCGAAT
TGCCGCCTACGTACCTACACAAAGCAGGATACTTTCTCAACCAAGAGCTCCGGGTTCAGAAACTCTAACAGTGATAGCAATGAGTTGATTGCGCTTGCTA
GCACGATGACGATAATAGTACATCTGGAAAGCCAACGACAGACCGAGCAAAAAAGCTTGGGTCGGTAATATCAACTACGACGCACATATTTGCCAACACA
ACATAGTCCCAGATCCTGCTCGTACTGCATGCTCTCATTAAACTTGCTTAGGAGGGGCACGCACCTTCCTCTTTCCTTGCAAGCTTGGAAAGTATGTTCC
ATCATTTCAATGCGTTGCTGCAATTGCAATTGATGCCAGAAACTGATACGACGTTCTCAATGTCAATTGAAGCAGCGAAATTGCCAACCGCCACGGAGAC
TTTCACCGACAAGTAAGCAGCAGAGCGGTCGGCTTAACTTGAATATGCCGACAATCGGCATGCGCCTTGGGTCATTCTGCTATCCTGATCGACTCGCGCT
ATCATGATGAGAGTGTCGATAGTGTCTAGCAGAGAACTCAATCTGCGGTGGTCTGGTGTGCGTATTTCATAGATTATTCAACACTAAGTTAGCAATACGA
AGGGATATTTCATCCTCTGCCAGCTCCAACAATGTTGTGACATCGTACAGTGCGCACCATAATCTTACCGACACCAGTTTTTTTTTAGATGTTGGATCTT
TTGAGAATTTTTACTCTACAAAGCTGATTTTTTGTCATGTTGTTGAACACCACAGTAACAATCTTGTGTGTTAATTTCAGCTCCATTGGACTTTTTTTAG
TCCACAAGAAAAATATTATAAAATTAAAGATAGACATAAACATAAGGACAGATGAAAACAAAGCAGTTTGGGGGCGTTTACGACTGGATTATTGCGCTCA
CAGGTCCAGCAAGATACGTTAGCGTTTGTGCAAATGTATAACATTGTTGATTTTGTCACAGGGGCGCAAAAACGATGCCAAAGTCTCCAGGATTGGCCAA
GCTCGAACAATGCAAGATTTTGGCGTATTCAAGCGTGAATATGTCAATTCGGGACATCGCGAAAGCTGTTGGACGCTCGAAGAGCGTTGTACATGCTTTC
TTGAAGAACCCCGAGGGCTATGGGACTAAGAAAAGCCCCGGACGACCACGTCTGTTGAAGATTCACGACTGCACCCGATTGAGAAGATACGCAGCAACTG
GTGATTACACGGCAAATCAGCTCCACCAGGAACTAAATATCGATGCAAGCGTCCGCACGGTGCAACGCGAGCTTCAACGGTGTGGCTATCTTGCGTTTGA
GAAGACCAACAAGTCTCCGTGCATGACCACCCACCACAAGATGATGCGCGTGGCGTGGGTTGAGAGTCAGATACGCTTGCGCACAGACTGGAGCCGAGTG
GTGTTCTCGGACGAGAAAAAGTTCAATCTGGATGGTCCGGATGATTGCAAGTACTACTGGCAAGATTTGAGAAACGACAAAAAGATTACATGGAGCCGTC
ATTCCGGTGGTGTAATGGGCCCTCATGGCCATTACATGGAGGTAGATGTGTGTGGCACACTACTTCACAGTGCACCATGGGTGACTATTACCGGTCGGAT
ACCGGTAATACCGCCGATACCCATGCGAACTGGTGACGTCATTGGATGATGTCACTGACTATTCCGGCACAGACAGTTGGTGCATTTTGGAGTAATCACC
ACTGGTCACAATCATGTGCGGAATGATGGTTCCTACTTGGGAAACTGTCTGGGTGACGAGACCGACGTGTCTCTACCATCTGAAGTGAGTGGCGGGAGCC
AATCACTTTACAGGGGATCTCCGCGGTACTTCAAGTTCAAGTTTCCAGCAGATCCCCTAGGTTCAACCTCAGTGTACCCAAGGTTTTATATATCAGATTT
ATAGGTTTTATTCCTGCATGTGTAGGTTTTACTTGTAAAACCTCTAGGAGCCCTTGAGGTTCAATTGTATGTAGC