Description :
From Genome Similarity Track
Location :
Scaffold_1174:1757- 6935
Transcript NameFunction/comments
g16614.t1hypothetical protein

Sequence
5178 bases(100 bases per row)
TGGACATTGAGCAAATGATGGAGCAGCACAACCCATTCGCTCAGCAGTTCCTGAGTTTCGGAGAGCAAGTGCGCTCGCGAGACACGAGCGACGTCGTGGA
TATGGTGTTCCGCCTCCACGAAAATATAGCGCATCCTCGGACATACAATTTGCCAACCGTTTCTGAGGTAGGCGCGACGCTCATCGAGGACGGCAACCTG
GATAGGCCTCGCGATCTACTACTGTATACTCGGGATCACAGGCTTCTACGACTGTTCGAGACGCGCCCGGAGTATGATCCTCTTCAGTATCCTCTTCTGC
TTCCGTATGGGGAGCTGGGTTGGACCTACACGGACACATACGCGAACGGAGTCAGACGTCGCAACAAGAACCAGATGTCCCTTCGCGAACATGTCGCCTT
CCGGTTGCACCAAAAAGTGGGAGATCAGTCTGCTCTTCATCAAGGCGGCCGTCTCTTTCAGCAGTGGTGTGTTGACCAACGCGCTAAATGCGAGCAGGAG
CAACTTCGCTGGGTGGCCTCACATCAGAAGCAAATTCGCGCCGATCAGTACCGAGGGCTTCAGGACGCACTGCTTAACGAAGGAACAATTCAGCTGGAAG
CAGGCGAAGGGCTACTCTCCGAGTTTGACAGAGGCGATGGTACGTTGGTCCACCCTGATCGAGGCCGAGGTGGTGATACCCATTTTCTCAACCAAGTGGG
ACGCCGCGTTATTCTGCCCTCATCTCATATGGGCAGTCCTCGAGCGATGTACCAGTCCTACCAAGACTCAATGGCCATTGTTAGAGAATTCGGCAAGCCT
GATGTGTTCATGACAACGACCTGCAGTCCTACATGGGAAGAGATAGTGGAGGCCCTTGGGTCCGATCAACAAAACGCTCAGGACCGCCCCGATATTGTAG
CCCGTGTCTGGCAGCAAAAACTGCAAGCTCAGATTAAAGACCTGAGCGAAGGAGTGCTGGGCCGTATGGAAGCGCGGATTTACGTGGTCGAGTTTCAAAA
GAGAGGGCTCCCTCACGCGCACATCTTGATCATTTTGGCTGAAGAGGACAAGCCACGTACTCGCCAAATCGTAGATCGTATGGTGTCTGCAGAGCTTCCT
GACAGAGAAAAGTTCCCGCAGCTATTCGAGACAATCATGACATGCATGCTGCATGGACCCTGTGGAGCGGGAAACCCGTCATGCGCTTGCATGAAGGACG
GGAAGTGTACGAAAGGATATCCGAAACCTTTTGCAGAGGCGACAAGGACCAATGTGAACGGCTATCCGGTCTACAGACGGCGTCGATGAGCTGAAGGCGT
CCTGGTATGGAAGGGCAGGGAGTACGACAACGCCACTATTAACCAGTGGGTTGTTCCGTACAACCCGTACTTATCCCAAAAGTACAATTGCCATATCAAC
GTCGAGGTGTGCACGGATATTTCAGCTGTGAAATATCTATACAAGCACGTCTACAAAGGGTCTGATAAAGCTGTGCTAACTGTCGAGGCAGTTCGCGCGG
GTGGAGAGCTCCCTCGGCAAGAGCCGAACGAGATTCTTCGCTTCCTCACGGCCAGGTACATATCTCCAGTTGAAGCCTGTATCCGCTTATTCGACTTCTT
GATCCAAGGAAAGACACACGCAGTCACTCAGCTTACCGTTCACGTTGAAGATGCCCAAACCGTGTTCTTCAGAGCGACGGAAGACCCGGAGCGTGTCCTT
GGTCGTGGGAATCACACCATGTTGACCCGCTTCTTCGAATTGTGTGCGAGCGACGAACCCGAGAACCAGATCGCGAAGACAATGCTGTACCAGGATATAC
CCAAGGAATTCCGCTGGATGGGAAACACGAAGTGCTGGGTTCGACGTAAAAGGTACCAGGCTGCAATTGGTCGGATGGTGCATGTTTCACCGCGTGATAT
GGAGCGCTTCTATTTACGCCTGCTATTATGCCATCGCCGAGGACCGAGGTCTTTCGAAGACCTGCGGACAGTTGATGGTGTGCTGTGTCCCACGTATCGA
GACGCGGCTGAACATGCCGGCTATCTGGAGAACGACAGCGAATGGGTTTTGTGTTTGTCGGAGGCTGCCGAGTTCCAGATGCCGTACCAGCTGCGCCAGC
TCTTTGCAACAATCTTGGTCTACTCGGCGCCTACGGATGTTCGGGGTCTTTGGGACCAATTCTTCAAAGACCTTTCGCTTGACTATGCGTACAGGAACCG
AGAGATGTTGGACCCTTTTAAAACGTCTGTTGTGACGTTCGACACACTGAAGAGTATCCAAGACTTGCTCAGTGTCAGTGGGTACTCCGCCCAAGACTTT
GATCTCCCTCGGCTGAGCGAGTTCCCTCGCCTGGTGCTTGAGTCTGTTCTGCAAAACAATCTCATCCGACGAGAGCTAACGGGATATGACGCGTCTGTTC
TTGAACAAATTGTGAGCGAGGAGGACCACCTAAACGAGGAGCAGCGCTTGACCTATGATCAGATCACCCAAGCTGTCGAGGACCCACAGGAAGGCAGGAA
GCTATTCTTCGTTGATGGACCAGGCGGTACCGGGAAGTCGACACTGCTTCGGAACATACTGGCCAAGGTTCGTCTATCCGGAAAAATTGCAATCGCGGTC
GCTTCCAGTGGGATTGCTTCTCTTCTGCTTATGGGAGGTCGGACAGCGCATTCTACCTTCAAAATCCCATTGAAGATAGACGGCGAATCTACTTGCAACA
TCAACAAGCGATCCCAGGTCACAGAATTGATGAAGAAAGCAAGTTTGATAGTTTGGGACGAGGCACCCATGGCGCATCGGCACGCGTTTGAGGCAGTGGA
CAGAACGCTTCGTGACGTTTTGGATAACGAGGCAGAACCTTTCGGTGGGAAAGTCGTTGTGCTTTCGGGAGATTTCAGGCAAATTCTCCCCGTGGTGAAG
GGCGGCTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCATAAGGTGCGTCTGACAGAGAACATGCGTGTTCGCA
CGGCTGCCACCTCCGATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGGAGGGTGGAGAGGGGAGACACGAGGTACACAACGATCTGGGAAA
TGACTACATTAAGATTCCACGTGACATGCTCATCGACAACCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGTCCGGGAGCTACTCCGCGAGGTATGC
GGCGCATGATCGACGAGATGTACGCCGACATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACTACCACGAACGCGAT
AGTCCATCGTATCAACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACAGACTCAGTGGAGGATGACGAGGACGGGAACTTA
TTCGAGCAGGAGGTGCTCAACTCCCTGAACATCAGTGACATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAA
ATCCCGACCTGGGGTTGTGCAACGGAACACGCCTGCGAATTGTCGAACTCAAAGATCATGTCATCCACGCCACCATCATGGCCGGCGACAGGCAAGGCCA
GCATGTGTTGATCCCGCGCATCGTGTTCATCAGTGATGGCGACATCCGCGATTTCCCATTTCGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTT
GCCATGACGATCAACAAGGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGT
CGAGGGTTACGTCGAGATCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGTACACGGCGAACATAGTGTACCGACAGCT
GTTCGAGAGAGCGTAGGCAGCGACTTCGTGTGAATGCATATTTTACGAAAGGAATACATTTGTCACTTTGCATAGCGGTAATTATTGAGAGTCACCATTC
CCCCTCGAGCGCAGCGAGCACGCCTGCGGTTTGAACCCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGC
GAAGCTTGCGAGCCGCAGCGGGCTTAGGGTTCGCACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGC
ACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACAATG
TGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGAAGGC
GAAGCTTGAGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGTGGTTTGAAGTCCGTGTGCGGAGC
ACGCGGGTGAAAACCCAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACG
TGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACCCAGGACCAAACAGTGCATGGTAGACAAGCGAAGGC
GAAGCTTGCGAGCTGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATACTGAGATAAAACATAACCCTGTCATAGTAAACAATAGTAGTGA
AGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCACCCACCGCCCGCAACGCGGGCGGCGCTCGGCTAGTCCCCTACAAGTAACAGAGTAA
CCTGTCCGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCTCGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCC
GAGCGCAGCGAAGGCGGCCTCCCCATTCGCCAATACTATAATTCGAGCCCTCTCATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATAATGCG
TAGAGTGGACTACACCACATCGGAACTAGCCGAATGAAAGCACTGCTGATTGGACAAAATAAACCGCCTTTCAACAAC