Description :
From Genome Similarity Track
Location :
Scaffold_163:17566- 19596
Transcript NameFunction/comments
g14435.t1hypothetical protein

Sequence
2030 bases(100 bases per row)
CAAGTTGAAGAGGTGATGCCGTTGTTCTGCTATGTCTGTGGTCTCGTTCGTATGGTATATTGACGTACAGGGTTGCTCTTCTGGATGTAGATTTCAGCTA
CACAGACTGCAGAAGCAGGTTGGGACGAAGAGGCCTTTACCAGATGGGCGACCAGAGCGGTCGCCGTGCGCCAGTTGCTCCACCAATTGGCCTTTGCAGC
ATGCATCCTATTTGGTCTCAAGCCGGAATCAGCCTACCTCGAAAAGCGGATAGTGGAGTGGCATTGGCGAGAAGCCACTCGTGTCTTTGGTATTGGCCAA
GTACGTTCTTTCGGATCTTGAGCAAGGTGGTATTATTGCGAGTTGACCCACGCAGATGTGTGCTATGTGTTACTGTGTTGCATCGCCAGAGTTGGAACTT
GGTCGGGGCAGAATGGTGGCGGAAATGGTGTGATTACGTTGGTATGGACCCTAAGAATGGAAGCCCCTACGGATCACTGCCTGTGCCGCAGATTCCTCCA
AATACGGTTATGGAGGCAGCCCGAAACATTCGTGGTAATATTGCATCACGTGCCTCTAGTTTCGGCGGAGAATCTTCTGGCAGCCGTTCAACTCGGCCTG
GGCTAATTGCTAACTGGAGCCTTCTCATGCAAAGTGGGTGCCGACGACTAAAGCAGAAACTGGTGTTGGCACGCGATTTTTATGTAAGTTATTTGAGGTG
TGGTCTGTATCGTCTTGTTCTGAAGTTGCAACTCGTGTTTGTAGATGGTTCCATCATCAGTCTACACCGTTCTGTTTTCGTGGTACAATGGCGGGCCTGA
CTTAGTCCGGTCTATCATCGAGGTTCCCACAAAGGCAGAACCGGCGCTTCAAGTTGAGCTCTTTCCCCTAGTACTACGCGTTGCGCGTGTTGACCCTGCC
AACGGCAGCGTGATTCGGTCGGGAGAAGAGATATTGCTGAGTGAATTGAGTACTTCAGCTAGCCTTCTTGAGGCTACTTGTCGTGCGCTGCTTTTGCTGA
AACTGATCGATAAAGCACGATTGTGGTACTTCAACGATAAAATGCCAGATCACAAAATTCGCCTACGCGACGAGTACCCGCTTGAGCTAAAGAAGTTGAC
ACAAGACAGCGTGTTCTTACTCGAAGTTCAAGACGATGACGGATCGTGGCCACTATCTCAGACGGATGATACAATCACCTCCTCTCCCTCGGAAAGCGGA
GTCCGTCAACCGATACAGGGAAATGGTCGAGGGAGTCAAAGTAGCACGGCCGAAGGTGTATCGCGTAAACGACAGCGCGAACATCGCCCGTCGTTACGAA
CATCTGACATTTGTTCCCGAGGCAACCTGGGTGAAGCTTTGACCCAACGTGGTACGTGTGGTGGTGTCCATGCAGATTCCTTTCAAAAGTGGCGCGATAC
TGACTTGCAACGTGTTGCTGGGGCTTACAGGATCTGGGAGTGAGGCCGGTTCTCCGACAATAGAGGTGGATCCTGTGCTTGCATCTCCCATCGTGAAAAA
ACGTTTTTCAAAGGACGCATTTAAAGGACCGGGCTTGGTGGGATTGGATAATCTTGGCAATACGTGCTATATGAGCAGTGCGCTGCAGTGTTTAAGCCAC
ACGCGTCTACTCGTTGAATACTTCAAAAACGAGGCATATCTGAAGGATATTAACCTACGCAATCGTGATGGCACGAACGGGAAACTGACGGCAGCATTTG
GCGAATTACTTCGAGTTCTGTGGATTTCTGATCGCAAACGTTTTGCGCCAAATGAATTCAAAAAGGTGCTGGCGAAATGCAGTCCGCAGTTTGCTGGATC
GGATCAGCATGACGCACAAGAGCTGCTATCGTGTTTGCTAAGTAGTCTAAGTGAAGATCTGAATCGCGTCGTAAAGAAACCGTATACTGAGCAGCCTGAT
AGTGATGGTCGACCCGACGCTCTGGTAGCAGAAGAGTGGTGGCAAAATCACCAGAAACGCGAGTATTCAGTGATTGTCGCGCTGTTTACCGGTCAGTACA
AGAGCTTGCTGGAGTGTTCCGTGTGTCGAT