Description :
From Genome Similarity Track
Location :
Scaffold_18:175653- 177858
Transcript NameFunction/comments
Phyke_g2724hypothetical protein PHYSODRAFT_483958

Sequence
2205 bases(100 bases per row)
CAGCTTTCACGATGCCCGGAAGGACTGGACAACATGATTGAGCTCAACCACTTGCACGAAGCTGCCATTCTGAGAAACCTCAAGAAACGCTTCCGGTCAA
GGATGCCGTACACGTACACGGGTGACATTTGTCTGGCCGTGAACCCGTATCAATGGCTGGACGAGTTGTATAAGCCTGGCCTCCACAAGCAGTACTTGCG
TGCATCGAAGCGTCAGGATCTACCGCCACACGTATACGCCGTGTCCGTTGCAGCTTTCAGGCATATGTGTGAGAACGGCAGCAATCAAAGTATTCTCGTG
AGTGGTGAGTCAGGAGCTGGAAAGACCGAAACAACCAAGATCCTCATGGACAATCTAGCGACTATTGCACCAGTGCCGAGTTCTGGTGGGAGTGAACAGG
AAGACAGTATTACCACGCGTATCATCAAGGTAAATCCACTGCTAGAAAGCTTTGGTAACGCGAAAACCACACGCAATGACAACTCGAGTCGGTTCGGCAA
GTTTACACAGCTCCAATTCAACAAGAACAACGCGCTTTGTGGTGCGCAGTGCAAGACGTACCTCCTCGAGAAGACCCGTGTTATCTCGCACGAACGTGGC
GAGCGCAATTATCATATTTTTTATCAGCTGCTTCATGGAACCTCAGCGGAGGAACGAGATGCATTGGGTCTTGGAGACGAGTGCCCAAGCTTCGTCTAtt
tgcaggagaaggagccACAGCAGGACACTCGGTCAGGGCGAAAGCCAAACaaagctgcaccaccagcactgaAGTCAGAGGCTGCGATTAATGCCGAGAA
ATCCAAAGACCAAGCACTTTTCGCGAAGACAAAGCAGGCATTGACGTTGCTCGGACTCAACTCTCAACAGCAGAACGACCTGTTCCAGGTGCTCTCGGGT
GTTCTGCACCTAGGCGAGGCAGAATTCTGTGCACAACCTGACAATGATGAAGCATGTGACCTGGTGAAGGACTCGGCAGTCTATTCGAGCACACTACTTG
GCCTGAACCCGGAAACTATGGGCAAAGCGTTGTGCCATAGAACTATGAAGGCTGCCGGAGAAGTATACTTGGTCCCGCTTACAGTGGAACAGGCGCAATC
TGGACGTGATGCACTAGCGAAGGCCATCTACGCTTGTGTCTTTGATTGGCTGGTAGCAGGTATCAACGCCAGCCTTGGCGCCGCGGTTCGCCATACCGCA
CACACGATCGGTGTGCTGGATATCTTCGGCTTTGAGAGCTTTGAGCACAATTCGTTTGAGCAGCTGTGTATCAACTACGccaacgagaagctgcagcata
AGTTCACACAGGACGTGTTCAAAGCTGTGCAGGAAGAGTATGAGCGTGAGAAGATCACGTGGGCACATATCGCGTATGCCGACAACAGCGATACTCTTGC
GCTCATCGAAGGCCGAATGGGTGTGTTAGCACTGTTGAACGAGGAGATTGTGCGTCCTCGAGGCAACGAAGAGGGTTTCGTGAGTAAACTGGCCGGTGCA
TACcgcaaggagaagaagctcatcgaCTTTCCGCGAATCTCCAAGACTGAGTTCGCCATTCATCACTATGCTGGCACTGTCAAGTACGAGGCGATGGGTT
TTTTGGAGAAGCACAAAGACGCATTATTGTCCAATTTGTCGGACCTCATGTGTGGCAGCCACGAGCCTTTCGCTCAAATGCTCTTTATGGCGaaggctga
agctgaagcggCCGCAGCTGCAAGCTTGAAGCGCTCAACTTCGGGCGGCTCCGGCCGCAAAGTCGGAGGTCGTGCAGGTGCgggtggagctggagccgAC
AAGACCGTAGGTAtgcagttcaagcagtcCCTGAATAGCCTCATGGCCAATATCAACGAGACAAACGTCAACTACATCCGGTGTATCAAGCCCAATAGCA
CCAAGAGCGCCACCCAGCTCGAGAACAAGATGGTGGCCAACCAGCTGCGCTGTGCCGGAGTCATCGAAGCCATTTGCATCGCGCGGGCGGGGTATCCCAA
CCGATTGTTGCATGCCGAGTTTGCTGAGCAATTTGACATCTTCCTAAGTAAGGTGGAGCAGAAGCGACAACAggaagatggagaaaaaTTCGGCGCTGCA
CACTGTCGGGTACTCGTGAAGCAGTTCAAGCTTGAGATGCCAGAAGAGTACCAGATGGGCACGACGAAAATCTACCTTCAGAAAGGTGTTCTGGAGAAGC
TTGAG