Description :
From Genome Similarity Track
Location :
Scaffold_2:17565- 19101
Transcript NameFunction/comments
Albla_Nc14002500
Albla_Nc14002510conserved hypothetical protein

Sequence
1536 bases(100 bases per row)
CCGACGAGGTGGAATGGCTTGCTGACGCGTGGCAACAACTCTCCATCGCATATTTTCGCCAATCCTCAAGGACTAAGAGCTGTCTGAATGCGTGCAGACA
AGTCACATCAAGCTGTAGTCTCGTCTTCAAGATAACAATCTTTTTGACGATGATGTCGGCATTGTATCTGTTTGTAACGACGTCGTCGACAGCATTCTAG
AAAGCAATGTGTAATCAGCGAAAAATACATGCTACTTTTGCTTCTTAAATAGACGAGTTGAAATTCAAATAACTTAACATTTTCGTGCGTAAGGCATGAT
GGGGAATTTGACACGCGACAATTCCGCTGGCCGAAGTGCGCTCAATGAGTTGTTAACCGCCTGGACTGTCAGCACATGTGGAATAGCTGCGACAATTCAT
GTACGGGTAACGACGGAAAAATTCGCCCACCCATAAAATACGCCCATGCTGACGAGTGCTGTAATTTTAGTATGGCAAACAAAATTGTCAATATCACCCA
ATCATACAGCGATAAGCTGAATTGATATATTAGCCAATCAAAAAAAAGGATAATGATCTGTTTTGCAAGCGATTTGACAGCTCTCTTTTCAGCTCTCTTT
TCATTTCCAGGCTTTTGCGTACACAAGATGGCTGTCGTCGCGGCCCCGAGAGTACCCAAACAGCGCCAGCGCTCGTACAATATCCGCGAGAAGATCGCCG
CCATCAGAGCCGCGCGCGAAGTGAGCGTGAGGGAAGCAGCAAAACAGTGCTCCGTCCCACGCAGAACGCTACGCGATTGGCTTGCGAAAACTAGCGAGTA
CGAAGAATTCTACGGCAATCTAAAGAAGACGACACTTGGGGGACAGGTTAGACATGAAGTGATGCCGTTCGTGCAGGAGCTTGCGACGTTTATGAAGGAT
CGCCGCAGAAACGACATGGTAAATATGAATGTGATAATACACTTGATATTTTTGTGTAACTTTCTCATTTTTCAGTCTTTCCACGTTTAGATCCTTGCGA
CCAGATACATGATCGGTTTTATAAAGGCCAATTACTTTGAGTGGATTCAGATCTATTTGAAGGAAAAGAAAAGCGAAGAGAGCGGTTATGCCGCCCTCAT
GAAACTATGCCAGCGCCTCGCAGTGCGGCACGGATTCTCGCAACAGACTGCATCTGAAACCAAGTAGCGCTTTATTGACCTTGAGAGTGTCAAACGAAAC
TTCAGTGCGACTTTTTGGAATGAAAATTCCGTGTTGGACCCTGGCGGTATTATTAATGTAGATGAGACAGGCATCTATTATGATATGCCGCCTAAAAAAA
TTTGGAACATTGTGGGCGAGCAACCAAAGGTTGATGTTCCCCAGTGTCATTCGGCCAGATTGACTGCTGTTTTGGGGATCAAAGCGGATGGACAAAAGCT
TCCAATCATGTTTATCGTAAAAGGAACACCTGGTGGATACATTAAAAAAAAAGAACTGCTTTCGTACCCCAAGGGGCACGTGTATAGAGTTCAGGTAAAC
GCTTGGATGGATACAAATGGGTGGCAATATTACATT