Description :
From Genome Similarity Track
Location :
Scaffold_473:17561- 18627
Transcript NameFunction/comments
Phymu_g10208conserved hypothetical protein

Sequence
1066 bases(100 bases per row)
AGCGCGTGGGAGCAATGGGGCGGCAAGAAGCCCACGAGCGGCGGGCTACAGGGCGCCCAGGACGCCTTCAACAGCCTCTTGCGCTCGTCTCCTCTGTCCA
CAgcgtccacctccagcacaGACAGCGAAGGCAGCGTCGGGAGCTCCCTGAAGAAGATGTGGGACTCGGCACGAGACTTGACCAAGAATGCGGTGGCTGC
TCCTAcatcctccagcagtgcgGCTAATAAGGACGCAGCCGATGCGTTGGAGAGTGGACAGATGGATGATGCTGTGGACGATGCGACGGCGGTGAAGTGG
CCTCTGTGGAGGAAGAATTCAAGCAGTCAAGGAGGACTTATTCCGAGCATGAGCTGGTAAGAATTAGATCGATTTGGGATGTTTTGGCGAGGGTTCTAAT
GTGCAATGTCCTAGGAATACGAGATTCAAGTACTTCGTGGCGATGGCTATGCTTGGCATGCTGTTCTTCGGCATGGCTTCCATCTTTCTGCCACTGGTAC
GGCTAGAATTTAAAAGTGAGTTTTTTTAGGATTTAACGCTTATTTTGTGTGTTTAGATCATGGTGAGACCGTCTAAGTTCGCGTTGAGCTTCACCCTGGG
CAGCATTTGCTGTATGGGTGCATTCGCTATGCTGAAGGGCCCGCAAGCGTACATTTCAgggctgctgcagccgaaCCGGCTTTTATTGACGAGCGCATAC
TTCGTGACGCTTGGTAAGAAATATCTTCGAGTTTGTGAAGGTGTCATTGAAGTGTACGTTGCCTGACAGATCTTTGTTGTCACAGGGTGCACACTGTATA
GCTGTCTTATTCTGGGGAACTACGTGTTCGTGGTGCTGAGCTCCGTGATGCAGCTGATGACGCTGGGATCCTTTGCGCTGTCAGCTTTTCCTGGTGGTAA
TTCCAGCTTAAAAGGTGAGTTATTTTGCCATTttgactacatgtacagagCGATACACTAACGCTTACTTATTTTGATGGTTTATTTAATATTCAGCTTT
CGGTGCATTGTTCGTGAAATCGGCCCGAGGCATGATCCAAGCGCTTGCTCGTCTCTTTCGGTAAAT