Description :
From Genome Similarity Track
Location :
Scaffold_604:17554- 19031
Transcript NameFunction/comments
Phypl_g9739hypothetical protein

Sequence
1477 bases(100 bases per row)
gctgaatACGACTGCAGGACCCGTCGCGCTACATGAGCCGATTGAGTGCCTTATTATCGAGGATGATGAACCCGAATTCATTTTGGGGCAAGATGTCCTG
AAGTCGCTCGGGATCGACATCGATCGGCAGTTGGAGCAGTTGGCGTtgcgcgacgaggacgaaggTGATGGTGAAGTAGAGCTGGACAACGACCTGCCTA
GTTTTGCCGCGTCGTGCAACGACAGTGACCTTCGCGAAGCACTTTAGCGGCTCGTAGTGATGGCTCTAGAGCACGGATTCCACGCAGGTTGGAACCGAAG
CTCCGGGCTATTGTGCTGAAGCACGACATCTGAAGACTCGAGCTGGGTAATGATCCGCCTGCAAAAGTGGAGCCACTGAAGATTCGACTCAAGACGGGGG
CCAGTGCCGTCAAGAGCACGCCACGGCGCTACCAACCTGCGGTGCGTGTGTTTCTGCGTGCGCTCAACGACAAGCTAGTTGGGCTCGGCTGGGTGTATCA
AACCCAAGCAGCCGTTGAGCCAGTCCAGTGCTCCCGGTGCTCCCAGTGCGCAAACATggcgacagcgccgacgagtACCGTTAGACCTATGACTATCGAG
TCGTGAACGATCGCATCGAGGTACTCGAGGAAAAAAGCACTTTGGTTTATTTGACCTACTGAAGGGCTTCTGGCAGCTACCACTTGACGAACTTAGCCCG
GAGCTAATGTCCTACATCACGGACACCAAAATCTACACTCCCCGTCCTATTCACCAGGGATGCTGTGATACTGCTGTGCACTTCCTGCAGACGATGGAGA
AATTCTTTGATTCGCTTTTGTATCATATCGTCGTAATTTGGATTGATGATCTACTGTTATCCGCGGATGACATTGACACCTATGTGGCCAAATTGGAGAC
ATTCTTCGATTTGGTGGCTGCTCATGGGCTCAAGCTGAGTGCTAAGAAGAACAGCCTCTATCAGCGGCAAGTGAAGTGGTGCGGGCGAATCATTAACAGT
GATGGTATCGCGCATGACCCTGCGCATATCAACGTACTACGCTCAATGTCGTACCCTACGACAGCCGGTGAGCTACAGTAGTTCCTGTGCTGTGAACTGC
ATGCGTGAGTTGATCGTCGACTatgctcgagctgctgaacctcTACAACTGAGACTAGACACTGCATTGAGTAGCGGCAAGCGCATAAAGCGTGTCGCCG
TAGGCATCTCCATCACAATAACTGATTCTGAGCGACGAGCCTACGATCAAGTGAAGGAGTTGCTGGCTGCTTCTGCTACGCTGGGTCTGTtcgacgacgc
tgccacTACTGTCGTTTGCTTCGACGCATCGGATAGTGGATGGTCAGTCATAAACAGCCAGGTTGCGGATTATGATCCACCAGAACCTGTCACcgctcag
cagcacaagctgcaAACGTGCCTCAGCGGTACTGTCAAAGGCTCCCAACTGAACTGGATAGTGATTGAGAAGGAGGC