Description :
From Genome Similarity Track
Location :
scaffold_38:175522- 177726
Sequence
2204 bases(100 bases per row)
TGGATACAAGGATGACGTCCTTAGTGCGAACTCGCTCTCTAGGCTTCCACCCGACGGTGGAGtttgacaagaaattgattgTATACCTGGTTCAACGCTT
GCGGTGcttcgacagtggccactgtcgcgGGAATAAAGTAGGTAAACCGATGAGTTCTTTGTTAAAAATAAGCTGCTGggttgatgaagaagatcaagGG
TTCTCGTAGCGCACTGACGTTTTGCGTACGTATACCAAATGATAAACGGCGTATTGCTCACGCATTTAACAAGTTGAAGGCGCAGACGATCCCTgcgcaa
acgccgattcTGCGTAAGGATGTCATCATCCACCAGGCGTCCGGCGGTTCAGTGTACTTATTTTTGATAGATGGATATTATCAAATCTCGATGAGCGGAG
AGGATGTCCCTTCGACGGATGTTACCGCACCATCCGGTATGTTAATGGTGTGGCTTTTGATATCACAGGGACTATCCATTGCCCCAGTAGCGCATAATCG
ATTGGTCTCACATTTGTTTCGACCACTGCGATGCTTCGCACAAACGTAACTCTGTCGAAATTTGTGTCAATTCGAATGACGAAGAAGGAAAATCTGCCGA
CGAAATGCACTTGGTGCACCTCCGTGCAATGACATTCGTTGCAAGCGAATCTGGCAAAGTATATTTTTGGTGCTAATAGAGTACCGGTCCTCGGTTGTTA
TGTTGGTGAACACGGTGTTCGTGCATACCCTGAGAAggtcaaagcaatcgtgAAGTGGCCGACGCCAAATAAATCAAGCCAAGAGGAAAGAATGGATTGG
TATCTCCAATTGCCCAGGTCGCTTCTTACGTAACTACGCGGGCATGTTACGCCCACTATCAAACTTACTGTAAAAGGACGTACGATGGATGTTGTCATCC
ATTCACTCGAATCAAGAACAGCTTGATGGAAGCACCATAGCTTGCTTTACCAGATGATTCGAAGCCCTATAGCGTGGTGTATGACGcttctgagtttgca
atcggttgtacattattgcaaaaggacttagaaggacacgatcgtgtcgtgtcctttcaatcgcgacagctgaagccaGAAGAAAAGGAATAGCatgttc
acgacaaggagcttTGAGTAATGAAATATGCTCTGGTGAGGTTTTGTGTTTACCGCTTGGGTTCAACTCCGTTTGTCGTCTACCCGGATCATGCAAGTTT
GCGTTATGCAGTTCAATCACCTCACTTGTCACAGCAAATAGTTCGCTGGTTGTTGatcttcgcagaatacaacttcaTCGTCGCGTACAAGCCAGGGAAG
TTGATCGTGCTTGCAGACGGATCGTCGTGTCATCCTGATTATGAGCTCGCTCATATCACTTATATCGAAAGCAATGTACTCAATATGATACGCCGAGCGT
TTATTGAGAATAAACAATTTAATCTGATCATCAGAGCACTGTCATCGAGTGATTTGGAATTCCATGACAAGCTTCCTGGTCGCTTGAATTTAGGCGTCAT
CGTTATATATGGAAGTATATTATCAGTTGCATGTGGCAACgggccacgaattgtggttccccaCAATGATGATTTGGAGTACAAGATAGTGCACGAGGCA
AAAGATATGCAGATGGCCAGTCACTTAGGCGGAGAGAGGACTTATCATTTATAcagttttcaattttgatggctCATATGTACAAGTGAGTGGCACGATA
CGCGATTTCTGCCAGCATGTGAAGAGCGCAAGCCACACGCTAGTGCCTCTGCATATTTTTCCTTTTCTTACTGACCGTTGGAAGTCAGTCGGTCTTGCCT
TATCTTGAGATTTGCCGAGAATGTGCACGACCACAATAGAGTCCTCGTGTTTGTTTACAAACTCAGTAAGAGGATTTGCAATGCTCCGTGTAGCGATTCC
ACCGATGCCAAAGGTTCGACTAGATTGTTCGTTGACACGTGTTTTGCAATTTCTGTTGCCAGAAGCCACCGTATCTAATGGTGTTGCACGATCTATGAGT
GGCTTTTGGAAAACATTGTTTCACTTTTGCTTGGATGTGTCCACAGCGGTACACTCGACGACCGATAGGCAAACAGCATTGATTGGCGATGTGGTGAGAC
GTTTGCGGAAATCTCGCGGAATGGGTTCGTTGTTACAATTAGTAAAGTATGCTATTTACAATTCAGTTCAATCATCCACTGAATGTACACCACTTTATAT
GAAT