Description :
From Genome Similarity Track
Location :
Scaffold_8:175501- 178795
Sequence
3294 bases(100 bases per row)
CCGGAGCAAATGGGACCCGTCCTGTTCCGGAGTTCTTACATCGATGACATTATCTACGGAGCTTCGTCCTGGGACGACCTGTGCAAAACCCTGGACGCTT
TGTTGTACCGGTTGCGTTACTGGAACATTTCGGTAAGCCTCCCGAAGAGCGAGTTCGGTGTGAAGAAAGGCAAGTACCTGGGACATGACATCAGCTCCGA
TGGCATCAGAACGTCGCCCAAGCTGGCTCAAAAGGTCCTAGACCTGCCGTTCCCGGGGACCCTTAAGGGGGTTCAATCCTTCCTGGGGAGCCTCAACTAC
TACAGCAAGTTCATCGAGGATCTGCTGGTGATTGCAGCCGTGTTGTACGAATTGTCTGACGAGCAGCTCCGCGCAGGGAGGGATCTGGAGAAGGCAAAGC
ACGCGTTCAAGTTGCTGAAGGAGCGCCTGGTATCTACGCCACTGTTACACCATCTGGACCCGGTGAGGCAGTACGTGATCATCCTGCATGCGAACAAGTG
GGCGATCAGTGCGGTCCTGGGGCAAGACTATGACGGAGTGATCCGACCTGTGCGTTTTGTGGGGCGAGTCCTCCAGGATGCGGAACTGAGGTACCACCCT
GCGGAAAAGGAGGCCCTTGCCCTGCTCCGGGTACTGAACACCTGCCACACGATGGTCCCTGCGTGCAAGGTGAAGACCATTCGAGTGTACACCCGGTACT
CTGTCCTGGGGTGGCTCTTCAAGTCGAAGACGGTGGATGGTCGGTGCCTAAAATGGGCAGTCAACCTCTCGCCCTGGGACCTGGACATTCGCCGCGTGGA
GAAGGACGAAGACGGACTTGCTGCAATCCTGGGTGCGGGCATCACCCCCAGGGAACAGCTAGACGAGATCGCTGGAGAACTTATCCCTTCCAAGGGCGCC
CGGATCAAGACACCGCCGGTCAGCCTCGAGATGCTGTCAAGTGACCACGTAGGTTTCCTCTTGAGTTTTGATGGAGCCGCCAAGCGAGATGGGTCTGGGG
GCGCAGCATGCATCCTCTGGGAATTACCGGCTTGGGAAGTCGTAGCAGCCGAGGGTCACCTCCTGGAGAAGGCCACGGTAAATGAAGCCGAGTACGCGGG
GATGATCCGAGGAATGCTGCTTGCGAAGTCCCGAGGCGTCTAGAAACTGGTGGTCGTGGGGGACTCCCGGCTGGCTATTTAGCAGCTCCAGGGAGTCATC
GGATGCACTCAACCGCATCTCCAAAAGCTGCTTCAAGAGGCAAAAGAGCTCCGAGAACAGTTCAAGTCCCTGCGTCTGGTTCACGTGGAACGCGACTTCA
ACGCAGCCGCAGATTACATCTCCAAGCGTGCCCCTCCAGGACCAGGCCTCGGTTGAAGTGACAGACCCCGGAGAGCTGAAACTGCTCCAAGGTCTGAACA
TGATACACGAGAAGCTGATGAAGGAGCCCAAACCTCGGGAGAAGGCGCTGGTAGATGCAGTCTTTGTGGCCACGGCACGAGGCGCTGGAATATCCGACTC
CGGGGATTCTGGACAGAGTGTGTATGATACGACCAGATCAGGGGCGCGTCTAGATCATCAGCCTGGGGAACCCCAGGAACCGGACGAGGACATTCTGGAA
TCGGAAGGTGGAGAAGAGACCGCTGTCGAAGTCCGAGGGCGCCGAAGGTACCCGTTAGAAGTAGACCCCGGTGAGGCAAGAAGGGAGCGTTGGAGACGAA
TATGTGCGCGGACCCGGACTTGGCCCCGCTGAAGAGCTTTCTCAGAGGCGAGACAGAGAAATTGTCCCTGAAGCAGACGGCTCATCTCGCCAAGATCGCG
GACCAGTTCGTGCTGGACAGCCAGGACACCTTGTTCTACGTGAGCAGGAATACCCCAGAGCGACCCCGGAACGAAGCGGTCCGACTAAGACTTGTGGTTC
CCCGGGACCTCCAGGAGGGCATCCTGCATCATTGTCCCTCAGACATCCAGGGAGTCCATCAAGGGATCATCCGGACCTATGAACGCCTGCGCCGAGAGTT
TTACTGGATTGGAATGTTCAAGGCAACGGAGAGGTCCATCAAGGAGTGCGTCGACTGTGTGATGGCGAAGGGGCTGCCCCGGAACCCGGGGCCGTCCCCG
GGAACATATTCGCTACACGGCCGTTCCAAGTCGTGTCCATGGACTTCGTGATCCCGCTGCCCAAAACAACCCGGGGAAATGAAGCTCTGCTCCTGTTCCA
GTGCGCTTTCTCGGGATTCATCATGTGCAAGGCAATGAAAGATACCTCGACCCAGGATGTGGCTGAAGCTTACGAGGAGCAGGTGTTTCGTCGTTTCGGC
GCAAGCGAGATGATCCGTCACGACCAGGACCCTCGGTTCAGGCTCGCGTGTTCAAGCACTTCCGGGAAATGCTGGGAAGTCGGCAACGTGCGACCCTAGC
GTATCGACCCCAGGCCAACGGTCAACAAGAGCGATCTGTGCAAACAGTGATCAGGAGTGTCCGGGCCTATGTGCAGACGGTCGACCAGAGTGACTGGGAT
GAACTCGCCGAGAAGCTCATGTGGGCTCTGAATACCTCGTACGACTTCACCAGGCTAGATACGCCATTCTACCTCGTCCACGGGTGGGACGCCCAAGGGA
CCGTCCAAGCAATGATGGGCGACGTCCCCAGGGACCTTCAACTCCGGGACGCTTATGAGTGGCGCCTGAAAGTCCAACGTCGAGTTGAGTACGCCAGAGC
ATGGGCCCGGGACCTCCAGGCGAAGGCGAAGGCCAAGCGAGCCCGGGAACACAATCGCCGATGGAAGCAGCTCTCGGACCGTCTGAAGGAAGGTTTTGAA
GTAGGCGACTCCATGTGGCTCTACCGAGCCCGGGTCCACCCAGGGTTGACCAAGAAGCTGGCCCACCTGTGGCATGGTCCCTTTAGGATTCTGGAGAAGA
GCGACGACTTCCGGTACAGGCTCCAAACCGAAGGCACGGACTATAAATTCTACCCCTGGGTGCACGTCAGCAGGTTGAAGCCCCGGGCCCTCTTCCCGGA
GAGGCCCTCCGATACCCTGGATATCCCTGAAGACGATGACTTTGACGCTGCTCTGCTCCGCGAAGACAGCTGGGAGCCCGACGAAGCTGCCGGTGAATAC
GAAGTGGAAGCCATCTTGGACGTACGCTGGGCTACCCGAACTCGTACCAGCAGACGGATCAAGGAATAAAAAATTAAGTGGAAGGGCTACGATGTCCCGG
AGTGGATACCCCAGGGGCGCCTGAACTGGGGACGGCTGCTGTACGAGTTTGACCAAGGAGAGCGCGCTCGTGTCCGTTTCCAGGCTATGCAGTC