Description :
From Genome Similarity Track
Location :
Scaffold_70:17550- 21089
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_70-abinit-gene-0.80SOP2
Pytir_DAOMBR486maker-pir_contig_70-fgenesh-gene-0.14SMYD1 protein

Sequence
3539 bases(100 bases per row)
GAGCGACGCGAACCTGTGGCACCTGGCGGAGGGCATCTCGTGCCACGCGTGGAACAAGGACCGCTCGAAAGTCGCGATCTGCCCCAACTCGAATGAGATC
TGGATCTACTCGGGCTGCCAGAACCCCGATGTGACCAAGTGGCGCAAGGAAGCTGTACTCACAGAGGTAGGTGCTGACTTGCATGCGCCGATCGTGTATA
GTGTAGCCGCTGCCTTGAGATGTGTCTGTGCGATGGATCGATTTGCTGACGACGTGCAACTCCTGCGCGGTTGTTGTTCGGTGTGTAGCATGACATGCTG
GTGAGCGGAATGGACTGGTCGCCTGTGACGGACCTGCTCGTGTCGTGCTCGCACGATCGAAGCGCGTTCGTGTGGAAGTATGAGTCGGCGTACCGTCAGT
GGAAGCCGTCGCTCNNNNNNNNNNNNNNNNNGTGCTACGTGTGATTCGCGCTGCGATCAACGTCAAGTGGAGTCCAAACGGTACGACAGATAGTTAGCTA
TTACTCATGATCATTGCACCAACGTGAAAGAGCTAAACAAGCGATGCTTTTGTGACCTGCAGGCCACAAATTTGCTGTCAGTAGTGGCGCAAAGTGCGTG
TCTGTGTGCTACTACCAGGCGTCTGAGAACTGGTGGGTCAGCAAGATCATCAAGAAGCACAAGTCCACGTAAGTTCTCTTTCTCTCTTTACCCCAGCTTT
GTGTTCGCTGGATCAGATGTCGCTCGATGGTAACTGATCATATCTGTGTGATTAAAATGTGATGACGACAGTGTGACCGACTTGGCGTGGCACCCAAACA
GCCAGCTGCTCGTGACGGGCAGCACCGATCTCAAGTGCCGCGTCTTCTCTGCGTACGTCTCCGATGTGGATGGAGCCCCAGACAGCGGTCCGTTCCCAGC
GCTCGCACCATTTGGTGAGCCACTCGCTGAGTTTGACAACGCGAACGCATGGGTGAATGCCGTTGCCTGGTCGCCAAAGGGAGATCGCATCGCGTTTGCA
GGTATTTTTGCGAGGTCTTGTTGAGAGCTGTTTAAAATCACGACGCTTGCTCACCACACTGTTCGCTCGCTTTTGATTTCGTTTTAGGACACGGATCGTC
GATTCATCTTGTTCACTTCGGTGCACCAGGTCAATACCCAACTGTCCAGGTACCTACGAGTCCCGAATGTTTGGTGTTGAGGTTTGGTTACTCTTGTGGT
GCACTTTAGGCTAATTAATGTGTGGGTATTCGTGCGCTTACTAGTCGATTCGCTTTGCCCACCACCCGCTGACGCGCATCATGTTCCTGTCGAACGACTC
GATTGTCGGTGTGGGCTATGATTTTAACCCATTGCTCTTCTCGGCGGATGCCAGCGGCTTCTGGTACGTTTTCTTAAGGCCACATTATGCGATATTGGAG
TTGAGGTTGAGACTGATCATTGGTTTTGTGTTATCAGGTCTTTCTTGGAGTTTGTGGACAAGAAGCCGGCGCAGAGTGCGGTCGCGCGCAGCACTGGCAG
CTTCAACACTGGTACGCAGCGTGCTTGTTCGAATGGACTTGTTAGAACAACTATGATCCTCACAATTTTGCCATTTGTCTGTGCAGCTCGTAGCATGTGG
GAGAGCAAGGTGTCTCGTGGTCAATCCTCGGACGCCACGCAGAGTGACAAGGGGGCGTTGTGGACGTACGTGACTGGCACTCTACAATTTTTGAACTGTT
CTCTGTGCTAACTCGTTGTGTTTCTTTCGAATCAGCAAACACGAGAGCACTATCACGGACATCCAGGCGTACGCTGGCTCTGGCGCTGGCAGTGTGACCG
AGTTCACGACCTCTGGTACGTCCGAAGGGTTATGTTGGCTGGATATTGTGGATTTCTGTGATACTGGAATACTTACTCGATTCGTTCTTTTTCTCCCGAC
CCAGCTCTTGATGGTCGCATCGTGTTGTGGAAGCTGGCGGGTCTGAATGTGCAGATGGCGAAATTGCGTCTATAAAAATGTCAGAGAACGAATTTTGACT
CCATCACCGAGCGACAACAGCATAATCGAGCGCACCGAGATGACGAGGAGTAGAGATCAGCACGCCCACCAAGGTCTACTGTAGATCTCCATCTCTCTCT
CTCTTCAGACGACCACCAACCAATTCAAAGGAACAACAAACAAAACAAAACAAGGAGGCAATACAACGTCTATTCATACAATCGCTTAATCCGACGATAC
TCTTGGCGGTATTTGTTCTCCACAAACGAGGCTTCGCGGAAGTCCTTCCACTCGGCAAACTCCGCGAGCAACGCATTCGGATCGTAGGAAAGCAGCAGCT
GGATGCCCTGACTCACATCGTTCAGCGTGCGCGCGAGGTCCATGTGACTCTCGTTCAGGTACGACTGCTGCAGCTCGAGCAGCTCGTAACTGCTTCGAAG
AAACAGGATCGCGTACTCACGGATGTCCTGATTCGGTTTTGCCTGGAGCAGTAGGTCGCAGCTGTCTGCCACCAGTTTGTGGATCCGAATGAACACAATG
TGGTCGTGCGCGACGATCTCCAGCGCGTCCGAGAGCGACTCCAGCGCGATCTGGAGCACCTGCGCCGCGTTCGTCTTGTTCTTCAGCAGCTCCTCCGCCA
CGCCCAGCACTTTCTCCAGGTCCTTCATCTCCACGAGTGCTCCACGTTCTTCTTCACTCGACGGAGGTGGTGGGTTTGGCAGGACGCTGTCGCCTCGTCG
ACAGAGTTCACAGATGCACACAAAGCCAAACTGCTCGCGGAGGTTCTGCTGGCGGTTCTCACGGCTCTGCTCGCGCGGGTACAGGTACGAGATCGTCAGC
GCTTCACCCTTCAAGATCTTCTTCGCGACGCGGACTTCCGAAATACCTGTCGCTCCCGAAACGCCCGTCGTCGTCGACTCGGGCGTGAACTTGACGCAAT
TTGGATTGCAGTCGTGGTTGAACATCGCGTTGTACAGGAACACGCCACTGTCGAATGCGTTGCACTGCATCGCGAACACGTTCTGCAGCAGCTCGTCCTC
CGACAGCTCGAGATGCCGAAAGTCAAGACGTAGCTGCTTGAGCAGGTCTCCGTACTTGGCTTGTCCCGCGACCAGCAGCTCGTCCGGGAGTTCATTGAGC
TGCTGCGGGTGCAAGTAGCTGAGATGGGTCATGATGTCCTTGTAGTCCACGCGCGAGAGGATGCTCTCGAGCGTCGCAATAAAGAACGATGGGTCCGACT
GCTCCACGTCGCTCGGCCAGGGCACATACACCTGCTCAACGAGCACACGCGTGCCAGGTTCCAGGTCTCTCGCAGCGGTATACCCTCTCTGCCCGCCGAT
GCCCTTGCAGTCGGTCACCAACTCGATCGGGCCAATCGAGAGCGGCTTGACGTCGTCCCATGGCGCGAACAAGCTGGGCACGTCCTCCTCTTGGTCGTCG
TCCGCGGCGTTGGAGGTTGGCGCTGGCGGAGGGAGGATGCTGAGCGAGTCCAAGGTACCGACGACCACCTGCTGCTGCTCGTCATCGCTGCTGTCGTCGT
CGAAAAGCCCGAAGGCCGCCTGCACGGTCTCGCTCGGCT