Description :
From Genome Similarity Track
Location :
Scaffold_522:1755- 2963
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_522-snap-gene-0.10VIP2

Sequence
1208 bases(100 bases per row)
TTTGCTTTTTCCTCCGTGTGCTTACGACGCCGCGTTGAACTTGACTCGGATCTCCTCTTCGCTCAACAGTCCTGCACTAAGTGAGTGGATGTTGCCCGTG
AACACACGTCGTTCCCACGTCGTCGTGTCAAAATACAGGAACTGCGGCCCTAGCGAGCCCAATGTTGCCGAAGAAGCCACACTAGAGCTGGATGCGGAGC
CGATTGAGCCGATCGCACCGATACTACCTGCACTGGATGGTGTCGCTGCAGATGATGCTAGTAGTGAGCCTGCCGATGCCGATCCGTTTGCAAAAAGAGC
AGAGTCGGCGGGTGTAGCTCTCTTGAGCCACATCTTCAGCTCGGTGTGATATCTCCAATCCCGGCTGTACAATTCCTGCGCTGCGTACGCTTGTAGAACG
TCCTTAGGCATCGAGTAGAAGATGTAGAAGAGCGTCTCTAAGTGGAACTTGGACAGATGGGTCGTCTTGAGTGCGGGGGGCTGGTTGTAGTAGCACATGG
GTAATGTGAACTGTGGCTCCTTTGTTAGCGGGCCTTCTGCCCAAGGCGACGCgAaCACTGGATGCAGCGGCTCTGCAGCATTCAGATTCAGCCCTAAAGA
CGTCAAGTCGCAGCCCATGAGTAGGTTCTTCTTGGcGTCGTTACTCGGGCGAATGACTGTGTGAAGCATTCCCAAAAGCCCGTACTGATTGCTAGGATCG
AGTTGACCGTTCGATGCAGACGCGCCAGGCCGAGAGCCATGCAGAGGTCCGAACGCACTAGTGTTACCAAGGTTCACGTTGCTCGCGCTGTTGTTGTTGC
TGCCTACGGTACTCGTAAGGGTACCTGCCGCACTAGCCGAGACACCTGATCGACTGCCGATCAGACTGTTGCCACCCAAGCCACTTGGTCGCTGCGATAC
CATGCTGTCATTAGCTGACGAGTGGAAGCTTGCATGACGTTTcAGCTCAGCATGTTCATGCATAGCGCTTTTCTCTGTCGAGTTGGGACCACTGCTGCCG
CCACTGCTGTTGCCAAACGGTGAAAGGGCAGGGAAGTCTTCCTTCTGGATCACGAATTCCGACTGCTGCGACCGAGTCGACGATGTCTCTGACGCCTGAT
CAAGCGCCCATGAGTTCGTCCTACGAGATCATgAATCGTCACCACTGCAACAATGtAAGAGCAAACACTTGGGGGTGATCCTACCTACTGAGAGCTGGGA
ACTCGGAC