Description :
From Genome Similarity Track
Location :
Scaffold_649:17549- 18703
Transcript NameFunction/comments
g11533.t1hypothetical protein

Sequence
1154 bases(100 bases per row)
GATGCATCCGATTTCGCGATCGGATTCGCACTGATGCAACTCGATCACGAAGGTCGTGACCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTG
AGCGCAATTACCCGGTACATGACAAGGAACTCCTTTCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTA
CACCGACCACGCATCGTTGCGTACGGCGATCAAGTCGCCGCACATATCACAAAGAATGGCACGGTGGCTGTCATTCTTTGCTGAATACAACTTCCAGGTT
GAGTACAAACCTGGAAGGTTGAATGTCGTGGCCGACGCGCTTTCGCGTCGACCAGAATATGCGGTGCAAGAGGCCGACGCCAACGCAGTTGGCGTCGTCA
GGACGACTACACCCTCGTCATCCTTGCTGGACGAAGTGAAGGCCGCATACGCACATGATGCGGATGCGAAGCAATTGGTGGAGTACTTCTCCACACCTTC
TGACAAGTCTCGTCAGAAGCTGGCCAAACCCCTTCGTGCCCGTGTACACCGTTATCGTGTACACAATGGTCTGCTGCTTTACAGCGCAGTCGACGACAAC
GCAGATCGCATTGTCGTGCCGGATGATCATGAGTTGAAGCTCAAGATCACGTACGATTACCACGATGCCCCGACATCGGGACATCCTGGCCGTGAGAAGA
CATACTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAGTGGGTACGCAAGTACGTTCGTGCTTGCGAGGTATGCCAGCGCATGAAGCCTGC
GCCCAACTCGCAGGCTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCAATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAG
CGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAACAAGATGGTACATCTTGCTGCAGTACCAGCCGAAGTGACAGCCAAACAGACGGCATGTCTGT
TTGTCGACATGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGAGATCCGTGCTTTACAACGCGATTCTGGCAAGAAGTGTTTACACT
TCTTGGGACGCAGTTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACA