Description :
From Genome Similarity Track
Location :
Scaffold_257:17542- 21231
Transcript NameFunction/comments
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_257-abinit-gene-0.40Ryanodine-inositol 1,4,5-triphosphate receptor Ca2 channel (RIR-CaC) family protein
Pytul_var.sporangiiferummaker-pug3_contig_257-fgenesh-gene-0.6Cbs domain protein

Sequence
3689 bases(100 bases per row)
GCTGTAGAACGGGTAGCACGGTGTGTACCAGCCGTTGTGTACCATGCACTGCTGCTCCTTGACGCGCACTTGGCGGAAACGCAGTCCTCCGAGACGCACC
CATTGCGACGTCACTTCCTTGCGGTCGCAAATATGATCCGTCAACGAAGCCGCAAATTCGTAGATGTCGCCAAATTTTTTGAGCTCGCACAAACCCTGTT
CACGACACGTCAATGAGCCCACGACGTCGTTCTGCTCATAACTATCTTGCACGGGGAGCCACGACAGGGTCGTGAAGAACAGCGTGAGGAAGATCAGGTA
CACGATGAGCTCCTGGTAGAACTGGCGACGCTTGATTTCCTTGTACTCGGATGCGACGGTCTTGAGGTCGAGCTTCTTCTTCTCCATGTGGATCCCCTTG
TGCACATGTGTCACGCTGGTCGAATCCTTTGCCCACATCGAGATGAACCCTTTCGCCGCGCGCTTGGACGTCACTACTTGATGGGCGACGCCTGCAAACG
TCGCAGAGGCCTTGCGCTCGAGTCCCTTCGGGCGGTCAACCTCATCGTTGCTCGTGGTATCTCCGTCCGTCACCACCATCTTCTGCTCACGGATGGAGTT
CCTGATATTGGTGCGCACGAGTGTCGCAACATTTCGCAGGCTCGGCTGCCGCACTGTTTTCTTTGCTACAAACCACAGCCGAAGATTAAACATTAGTCAT
GATGGCAGCGTACAATGCGAACCAATATGGACAGCACTTACGTTTGGCCTTCTTTGGGGCTTCCAGGAAGTCATCGTCTTCGCTTGACTCCTGTCGAATG
ATTGTTCCGAGAGAGCCACCAGAAGGCGTGCGGAGATGGCGACGACGCAAACTCCCTAGCACGATGCCACCACCGGGCACTGCAACACCGTTACCGCTGC
TCGTGCGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNAATGCTCGCCATCTTGCGCGGTTTCGGGGGAGTCAGGTTCTCTTGCCCATTCTCACTAGGATTCGCGCTCTCCTGTA
CAGTCGCCACTCCATTCTCANNNNNNNNNNTGTGTGCAGCCTGCAGCACCGTGGCCACGACGTTTGCTCCGTTGTGACTCTCACTTGACGACGGGATCAC
CACGTCCACTGTCACCTCTTGTGTCTGCTGAGCACTCGCGTCGTGCCCACCATTGGCCGTGGACGCACTCGCTTCGCCACTTTGCGCGTCCTCCATCGTC
GTGGCCGCGATCACTTCTGTGGTCACCTGTGTCGTCTGAATGGGGGCTGTGGGTCCCGCGGAGGATCCCACCGGCTCTGCTGCTGCGACATCCGCTGAAG
CATGTGACGGCAGTGCCAGAGACGGCGGTGACGTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCACCGACGCATCGCCAGCAGTGCCGTCCTCTGT
CGCCTCGTTCATCCTTGTTCCAGGGAGCAACGGACGCTTGGTGGCGGATTATGCACCGCAAGCTGTCTTATAATTCCAACGAAGCTCTTCATTCTTCCCC
CCTTCTAGGGAGTCGAAAAAAAAGGTGCCGCCAATTGATGTGGACTCCACAATTTTTTAATAAATGTGGGTGAATGTGTAATTACGCACGCGCTTTTTAC
GTAAAAATGTTACTGAATTCCTCTGGGATTACATATTGAAGCATGAACCCAAACGCTCTACCCCTCTCATAAACGATATTTACCCTCTTCTAAGAAATAT
AATATGCATATCTTTTCGGATATACTAAAAAGACAAGAAGCACACAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTGCGGAGGCAGACACCAAGCGGACAGAAGGGAACACTCAGTTTATGAAGAAGATGATGAAGATGCACGCAGCGCGCCGCTTCCTGTTGACCCGCAGTTC
CAGCATGGCACTCGCGAACNNNNNNNNNNNNCGCCGCCGCTGAGCCGCTCGTACCACTACAACAAGGGCACGGCAAAGGACATGATGGAGAAGAGCTGCT
ACCACGGTGTCAACTTTGTGATCTCGGAGGACGCGTCCGTGTTTGACGCCATCACGCGCATGGCCGGGATCAACCTCGGCTGCCTCGCTGTAAGCAGCAA
GGACGGCAAGTTCACGGGCGTCGTCACGGAACGCGACTACCTCAAGAAAGTCGAGTTGCAGAACCTCACCGCAAAGGGCACGAAAATCTCGCAGATCATG
ACAAAACGCGCGCGCCTGATCGTCGCGGAAGAAGACGAGACACCGGCACAGCTCATGACGAAGATGCTCTCGAGTGTGAGTATTTTTTTTTCATTGCTTT
CTGGGGGGAAATGGGAACGGAAGTTTAAAAGTGATATATATTGTGGTGTTTTTTGTTGAAATGCTTGTAGGATATTCGTCACTTGCCTGTGCTGAACGGT
GATGGCGATCTTGTGGGCATGCTATCGATCAAGGACATTGTGCGTGAGATCAACCGGGAGTACGACGCAGACATGGACACGCTCAGCAGCTTTGCACTGG
GTAAGGGCGGCCACTTTGTTCTTGACTAAGTGCGACGCGTTGAAGGAAATCAAATACAAAAGCGTGAGCAGCAAGGTATGGCGAGAACGAGAAACATTTA
TTGCCTAATACATGATGGAAGAAAAACAAACGAGAGCGAAAAAGTGACAGCGTATGGAGAGTTAGTTCTCGCGTCGATAACCCAAGCATAAACATTCATG
TTTGAGCAACTGGTTTTCGCGTCGATTGATTGCAAACGAAAGCGCATCTAATAGCACGCCCAGTGTTGTGCAGTTTACGCATCTGGCATAAGACAGATGC
GCGTAAACGTGCATTATGGACACTTCGCTTCTTCCAACCTGTGCAGCTCGCTCTCATTGCGACTGTCGTTCGCCACGAACAGCACGACACGTGAGCAAGA
ACGAAGCGCTGCTCTCCCTTCGGCAATGGCGTAGCGCTCGATAGCGTGGCTACATGTGACGTCATTTCCACTCAGCCTTTCGCGCATGGGTGGCGCCATT
CGGGCGCGTTTTTTTTCCTGCCCACTTGCAATGGAACAATAGAACAGAAGAAAGGTGCTGTGGCCGCAGAGTCCCACCCACTTCACTTCAATGAGTGCAC
GCGAATGAGCAGATACAGCCAGCTCTGTGGCATCAATCCCCGGCACAATATTACTGTGGAAATCATACATGGCCCATGCCTCTACAAGGGCGCGTTCTGT
TGAAGCAGTTACATATGTACCGTGCATGCTCCACTTCAACAAGCATCCACTAGACAAGCAGACCCACCCGTATCACGGCCGCATGATTGCATTGCAAGTC
AACAATAGAAAAACATGGTGCAAGGGCGACGCTCGACTGTCTCATATTGTATTACGCACGTGTATGTGTGTAGAGTCTCCTTCTCAACAGCATTCCAGTT
ATTCCGCACTGCCCCTGGTGTCCAGTACTTAGTAGTAGTTTGTAGTTTCCTGCCTCGCTAGTATAGCAAGCAGCACAATGAAGCATGGTTTGCACAATAT
AATAGGCGTGCGCCGCAGAAAAAAGAAAAAGAAAGTGAGCCTGTCATCTCATCATCAAACTACCGAGTCGTACAGTAGGACACAGCTCA