Description :
From Genome Similarity Track
Location :
scaffold_320:17540- 23097
Transcript NameFunction/comments
g7225.t1hypothetical protein

Sequence
5557 bases(100 bases per row)
ATGTCTGTCGACGCTACAGTTCGCCATATCTTCGGCTACGACGGGAGTTCCGGCGATTCTCCGCCTCTGCAACTTGCAGATGAGACCACGCTGGTGTATG
TGAGTGGCCACACGCTGCACTTCACGTCCACGACGGCCCAAACGCAGCACTTCCTGATCCGTTCTCAACCTCGCAAGCTCGTAGCGTTCGACTTCAACTG
GAAGACGTCAACGTTCGCCATCACCGCTCGAGAACCAGAAGCCACAATCTCGTTGAATTCGTATCCGGACAAGAAGCCCAAGGCTCAACTGGAGCTGAAA
GTCAAACGCAATGGTGTCTTCGAGTATTCTTTAGTCAAGTTTTCCCGTTGTGGGCGTCGCCTATTGAGTATTCGTCCATCACCTGATACAGACGAAGAGA
AAACCTCAATACTTTGTGTCTGGGATTTAGAGACTTTAACTCCTGTCCCTGGATGCGAAGACTCTACTGTTCGAGGGAACACACGCTTTGCGTCATTTGA
TCCAGCCAACGTAGATCAATTCATCGTGGGGGGTGACAACGGCCTTCAAGTCTGGAAAATCTACTCAGGTAGAACAGCAGCCTCGAGTCTACTACGAGCG
GAGACTGTAGTGCTCCCTGTTCTTTCAAAAGATGAACATTCAGTCGATGTAGAGTGGGAAGAGAAGCGGAAGCAGTTCTACTGCCACGCGTGGCTCCCAC
ACAGTCGCTGTCTCGTTGCGAATTTGGCGGGTGACCTGCTTCTACTGGATGTGAGTGAAGTGAAGATCCTGCAGCATATCCAGACAGTAGCGAGGCCCGA
TCGTTGCCATGTGGCGGGGCTTGTGGTAACAGCAGAGACGGTCGTTGTGGCGTACTCTGACGGTGCTTTAGCGTGGCTTCAGACCGACAATTGGGAGTTG
TTGAATACAAGCGTTCTACCTGGAGGACCCACAGTCGTGACGGTCATGACTCCGACTCCAACGTACGCGAAAGCCTATGTGGGCACTCGCAATGGCAAGA
TCTTCGAAGTTCGTACAAGTGTTCTACAAGATGATGAGGACGACGTGGAGAACGAAGAAGACGAATCTACTCGTACTACCAGGGAAGCCAGTGGCAATGA
CGAATCCTCTTTAATTCTACCGTGTGCTAGCTTCCCTACAGGCCCAGCATGTGACAGTACCGTGATCACTCCATTCGGCGGGACATTTACTGCCGACGCA
TTGATAGCTACAGGTGGAATGAGTGGAGTCCTTGCGCTCTGGAGTCTTCGTGACTGTCGTCCAGCCGGAGAAGCCAACATCGCTGCCTTGTTCACTCGAG
AACTGACTACTGAAACTACCAGTTCACGACCCGGTACTGCTGGTGGTACTACTTCTGCTCCTGCTCCAAACGACCTTAGTGATGGACCAGCTCCCCCTCC
AATTGTAATAACTGCTCTAGCATCACGCCCAGCAGATCCTGTAGTGATGATTGGTGACCATCAAGGAAGACTTCGCTCTCTCTGTATTGCGAAAATTGTG
GGTGGAGGAGGCAAAATGGAGATTCTACCGCAGCATTCAACACAATTACTGCCTGTTGATATACCGTTAGACCTTTTGGCAGTCCACCCTACCCAAACAG
TGCTGATGGCGTCATCTACTCACAGTGGGGCGGTGTTCTTGCTCTCTATGGACCATGAAAAAAGATTCCCCGTTCTGGCCTTTTTCACTCTACGTGAGCC
AACGGAACGGGTAGTGGACATTCAATGGAACGTCGGTGGGGGTAGTACGAGTAGTTCACTTACTCTTACGTGCTTCTCCTCGAGTGGGTTGTTCTACAGC
GCCAGATATCAAGCTCCACCCCCAGAAGATATCTCCATCGGTAGTGCAGCTGCTGGTCGTCGAGATGCTTCACCTCGAGGCGCGTTGCTCGTTCTCCCCA
AGGTCATCGCTTTCGGAGAATCCGTTCTACCTATGTGTTCAAAACTACGTTTCCTCGCTGCTCCTTCGTGCAACATGATGATCGCTACTTCTCCTGGTCG
TCCAGAACTCACACTACTAAAATATCGAGAAGTAGTGCGAGAATCCATGGAGGAAATTCGGATTTTATCCAAGATTTTGACTAAAAACGCTCACGCTCGT
GGAGTCTCAGCTGTCACTGTCTTCCCTCGAGTTCTTGACGGTGGCGTCGAGTTACTTGTCACTGGTGGGATGGATGGCACCGTCACGCTTTGGACTCTTG
CAACAGTAAACTGTCGACGTCAAATCAAAATGACAAAAGACGTAGACAATGACGAAAAAGAGGTTTCAGGATCCGACGAACTCGAGGAGATGCAAGCTAC
TAAGAAGCGCACACTGGTGATGCATAACGGACCAGTGACGACGCTAAAGTTCGTTCTAACTAAAGGTGGGATTCCTTCGGAGAATGGCAGCTCTGCGAAC
ATCCAGTTGGTTTCTACAGGAGCGGACGGTTGTGTCTTTCTACTGGACGTACGTTTGTCTGGCGAACTACTAGGAGAAGCGATGGGGTTAAGTAGTTCTC
ACAGCCAAGAACCGACCATGAATCCTCTCTACATGAACGTAGTTTCAACCGCTAAGTACGACGATGTTTTCCAACCAGAACGGGAAGAGGAATGCACACC
GTTCCTTGATGCTCGAGCACGTGCAGAAGCTGTAGCAGCTAGGGACCGCTTCGATCGAGGTAAAGATGGCACTCGTGTGAAGCTTCGGGAGCTTGAAGGA
CGACTGAAAGTCATGCTAGCTGAGAATGAACGACTAGCGGAGAACGAACAGCTCCCCAGAGAAGAATTCGTGCTGAATGTGGCCTGGAGAGACAATCTGT
TAGCTCAACATGCTGCAAAAGCTCAACGTGTACGGGAAGGAATCGCACGCGAGCTGGCTCGAATGGCGATTGTCAGAGAACGGATGAAACGCGAGTTCTG
GGACGTCTCGGAAGTCCCTGGAGTGCGTCTTACCGCTCTTTCTCCACCTGCTACAGCGTCTCCAGTTCCAACTCAGTCGACAGCAGGACCAACGCCTTTA
TTCGTGAACAATTTCCCACTGGGACGCCAATCTACGGCTGAACAGAAGCTCGCCAAGCAGATAAGTATGCTTCGTCTAGTGGAATTTGCGCACCACCAGC
AAGAAGATCGAGAGGCACAAGCTTCTGAGTCAAGAGTGAGGTTTCAAGAAACAGTTCCCAGTGATTTACAGTGGGTTTTAAACGCTGGATCGCTACATCC
CAAGCATCAAAGCACCGGTACTGAGACTTCAGCCGCTTTAGACATCTCTGAGTATGCGAAGCTGCCCAGTTTCCATTTTGTGTATCATCCTGCAGCTGTC
CGGACCCAAAAACAAGCTCGAGTTCAGATGTATTTGCTTGGATGTTATGTTCGATCCCTACAAAGTGCGTTTAATGGCGAGTTCCAGGATCTGGTACGGC
AGAAGGAGAACACGATGGAGCAAATCGACGCTAAAAACGCTCGTATTGTGGAAATTACAACCGAATTAAACGCTGGAGGCATTGGAGACCTGTTTAAACC
CCAATGGGCACCGGAGGAAAAGGCCGACTCGATCTTACAAGTGACCCCAGAAGAAATGACGCAAAAGCCTTACGAGACTTCGGAACGACGCAAACAACGT
GAAAAAGAGGCGTTGGAAGCTGCTGAACGGGAAAAACTCCGTAAGAAGGACGACGTTGGCGGTCGCGCCTTGATGGACATGATGGACGGCACTCTTGAAG
TGAAAAGGGACCCTCTAGCAGCTCAGGAGCTCGTGAAAGAGGCCTGGATGTTGACGATTCCTTCTGAAGAGATGACAACAGAACAGAAGAAGCTTGTGGC
TCAGTTCGAATCCGCACAAGCCAAATTTGAAGAAGAACGAGAAAAATACCGCAAAAGTCTGGACTTGGAGCTGCGAAAGACTCGAGGTGAAGTTATTGAT
CTCTGTCGAGCTTTTGATGAAAAGTTAAAGGCTCTACGGGAGCGATATATGGCCACTCGTCGTGCTGTATTGGCTCAAGAACTGTACGAACTGCGCTTAG
GTGAGGAGCTCCTGGCTCGTGAACAACTCGGACTTGAAACGCGACGACTGGAAGAGGAAGAACAGACGATGAACGACACTGAAAGTCACGCTCAAGCTGA
AAGCGACCGCTTCACAGCGCAACTTGAAGCTTGTCGGGAGGATTTACATCGAGCTACTGAAGAGGACAAACTTCTGGACAAAAGCTTCGTCCGTGAGCTT
GAAGAAATGGTCCAAAGCAGCAGTAGCGCAGGTACAGGAACGCCTAGTGCAAGTACCAGTCAACTCGAATCTCCGGAATTCGTCAAGATACTTCTTGAAT
TGTATCGGAAGCGTAAAGCTGACGACTTAGTGCGAGATGGAGCGTCAGGGCAGGTTACAATCAAGCGTACTGGTTCCAACCGAGCCAAAAGTAACGCCAA
ACAGCGTCTGCTAGCTGAAAGTAAAGGTGAAGGAGGGTCTTCTCGTACTTTATTGACACAAACGTCCAGTAAGAACAACATCTCCGCGTCTGAGATCAAC
TTGGATCCATTCCAGCAGCTGGATAACATCCGCCGGGATAATTCAAGACGCGGAAATCTCACTACCGGAAGCCAATCGTTCGCTGTAGCCCCTTTGGACT
ATGTAACTGACCGTCCGGAAGGAGTTCTCATTGAAGACCGTATCTGGCGAGCGTTAAACGCTCTTCGAGCCAAGAAAATCCTCGCAGAACATGCCGTGCG
TGAAAAATCCGAGATTTTAGCTCTGGCCAAGACCGTGAGCGATGAATTACGCGCTAAATTGTCAGAGCTACAACGTGAGCGAAGAAAGCAACAACGTGAG
CGAGAATCGTTAAGTCAACGGCGAATGGAGCTGACTGAGAGCGCTCCGTTGCTAGTTCGGATCAAACAGGGCCAAGATGAGACCCCCGTGGGTGGAGGAG
GTGACGACGCTCTGCTGGTCGCTCGAACCAGTGTTGAAGCTCTAAACGACGTGATTCAGCTGCACGGCAAAGACCAGGTTGGCATTCTTGGTCGGATCAA
AGACTTCCGCAAAAGTATCAACGTTATGGAATGGGAGCACGCTCTACTGGAGCTTCAAGCTCGGGATATGGACGAACGGTACACTGACATTCAGTTGCTT
CGGGTCACGAAGGAGCTGCAGGAGCTTTTCCATACTGGAGACACGTCCCACAAACAGAAGCGTGAAGCGGCCATGCTTGAAGCGAAACTGGCGCATCTAG
GACGCCACCACCAGACCAGTTTACTCAAGCTTGAAAGAACGGGCTCGCAACTGGAACGGCAACTGAAGGACCGACAACGAGAGAACCGGAACTTCCAACA
GCAAGTGGCGCAACTCGAGACTCAAGTGCAGATCCGTGAAGACATTTTAGCTAGTCGGACAAGTGCAGCCATGCGGCAACAGGCAGGAGGAACGAGAGGT
GATGCAACGAGACTGAAAGCTATTGTAGTGAGGCGGAAACTGGTGGATTTGGCGAAAGCTCAGACGGACGAGATTGAATACCTTCGTCTTGAACTCGACA
AGATGCGACGTCGCACATTCCCCAGCTTCGCACAAGCCCATGCTCGCGACTATCATG