Description :
From Genome Similarity Track
Location :
Scaffold_14:1754- 4667
Transcript NameFunction/comments
Phymu_g990hypothetical protein

Sequence
2913 bases(100 bases per row)
CGCTATGCCggcctccaagaagcggatTCAGAACCGCGGCACGCTCAATGTGGGCACGCAGCAAGTTCCAGCGGCGCTGAGGGACTGGGTGCACATTTGG
CACGGTGTCAAGGTGAACAACGGGTCGGAGGACACGTCTATCTTCCACGCAGGCTCGCGTATCGAAGAGATGCCGTTCTGGAAGCAGTTTATCCGACTCC
CGTCCAATTCGCTGTTCCCTAGGGTTTTCACCTGCTCCAACCCGAGAAAACCGTACAAGGATTTCCtctacgtgctgctgaaTATGCGCTGGCCCATGCT
GCTGACGGTTCTGCTCTCTATTTTCATGATCaacattttcttcttcgcagccGTCACGTGTTTCATATGTGGAGAGCCGACCCATTTCTTCGAGGCCTTT
GACTTGAGCTACCAGACGTTTACCACCATTGGATTCGGTGTGGTGTATCCTACGCACACGTGTGGGAACGTGACCATGTCCGTGGAATCTTTTGCGTCGA
TGATGGTCGTGTCGGCTGTTACGGGTCTTGTGTTTGCCAAATTTGCCAAGCCACAGGCGAAAGTGGCGTTTAGCAAGGTTTGCGTTGTGCAACCCTATGG
CAAAAAGTATTTGGCACTTGTCGTGCGAGTGGCAAATGCCACGCAGTCACGAGACGTGACGCACGATGTGATAATGGAGGCAGTTTTTAAGGTCAATTTA
CTACGTGTCGAGCACAAGACGAAGCATATTCGAGCGCACGACGATCAAGTTACGGAGAAACGGAGACTTTCCCGAGCAGCGAATTGCATGATGCGAGATG
GCGAAGACGTTGTAGCTGATACTGCTTGCTCTCCAACTAAAGTACTGACGTCTTACAATctcaagctgttgcagaaTAACTTCATTACGTTTCGCATGGG
CGTCGCCGTAGTACATCTCATCGATGAAAACAGCCCGCTCTATGGGATGTCCAAGAACGATATTGCTCAGTCCGATATGCTAGTGGAAGTCGCTATGTCT
GGCGTTGACTCAACGTTGCAGGACACGGTTTCGGAGCGGTACATCTATACGGCAGCGAACTTGATGTGGGGATATCGCTTCGCAGAGCTGCTTGACTTCA
ACGAGCGAAATGCTGAGGTCATTATGAATTTTGCGAAACTCAGCGCGGTAGAATCCGCCCGAATTGACGATGCGAAGTATCTCAAGCCAATTTTCTCCAG
CGAAAAGCCTCGAGATAGCCTTCAAGGCGATGGGTATACGCACAATGTGGCCCACAGACGCTCACACCGAAAATCAAGAGTATCTCACCACGTTGAAGAG
AATTATCCTTATCACGATGAGGCCATCCATGAAGTGCCGTCGGAGTATTCCGAGTCTGTCCTGCTGAGTTCGCGGTCGGGGTCTTTGGACGGACAGTCTA
CAATAACGGAAGATGCTGCACCTGCCCACCCCCACCCTCCTGTGTCATTTTCGAAGAAACCTGGGCCGAAAAAGTTTGCTTTGGGGCTCGAACCACTATT
TGAGCCATTGCTACAGCAGCCTTTTGGAACTCAGCGAATACCAAAAGCTCCATCTGCCGAAAGTAAGGCGGCAATGAGGGGAGGGTTAAGAGTTTGGAGA
GAAAAGGATCACACGAATCTAGAAGAAGGGCGACGTAGGTATAGCGCGAAGCATTTAACTTCAAGTGGTGGCGCGAATACTCGTGTTCGCCATGGTAGCT
CGGATGCACGTAACAGTGACGGTGGCAGGGGTTCTTTGGAAGGCACGACCGGCGTTCGAGCGAAGAATCTTCTTCAAAGAGAAATGGCGGGGTCCGCATT
GATAGACGATGATGCCAGTACAATTtcacaagaagaaggccacaAGGATGAGTTGGATGAGTGTGAAGCCATTGACGGTATTGAGGATATtgaggatgac
gatgacgattacgaagacgacggagaagacgatgcaagtcggcagcgtcggcgtGCTCTAACTACGCTGTCCGCTGTGTCAATTGAGGTAGAAGACACGC
CTCGCTTCTTGCGCATTTTACCCGTTCACATCCCGAAGTCATTCAGCTTTATGCGCCTCTACCAGAGCGCTCTTCACGTTCGCTGGCCTAAAATCATCGT
CGTGTTTGTGCTATCGTTCCTGGTGATCAATTTCGTCTTTGCACTGCTGTACTGGTTCGACGCGGACAACATTTCATCTTACAGCGATGTTGTGGTCACC
AAGTACGAGCTGGCGTTCTATATGAGTGTGCACACGCTGGCGACCATTGGCTACGGCTCCATGGCACCTATGCCTAAAGCAGTCTACATGAACGTTGTTG
TGTTCATCGAGTCGATGGTGGGGATCATTGCGGTGACGATCATCACCGGTATCGCTTGGTCCAAGTTTGCACGGCCCCGAGCTCACATCCACTTTTCGTC
GCAGATGACGATCTCAACCATCTACGGCCACCGGTGCCTCGTATTCCGAGCAGCTAACACCAGACACTCAGGCGAGGTGCAcgagaacttcttccgcaTC
GGCGTGATCCTCACAAACCGGCGCACAGGTCTTCGTCAAATGTACGACGTGCCTCTGGTGACTGCCGAGTGGCCGTCTATCAAGCTCCCAGCGACGCTGA
TCCACGTCATCAACGAGAATTCGCCGTTCTACAAGTTTCACTCCATGGAGGACCTCTCCCAATCGCGCGTGGCGGTCATCGCGTTGCTCACAGGACTCGA
CACGACCTTTTCGGAGAATGTGTACGCGCGCAAGATGTACTTCTGGGACGATTTTGCGTACGACATGCGCTTTGACGACTTCGCTGTCATTGAGCGAGAT
CGCGTGATTGTAGACTACGAGCGCTTCGATCGCCTTATTCCAGAGGATAGAGAGGAGCAGGTCAGCACCACGCCGGTGCTCTCAGTGAGATCCTCACTTG
CTGACATAGTGTA