Description :
From Genome Similarity Track
Location :
contig_12:175359- 177178
Sequence
1819 bases(100 bases per row)
CCGGGACATGTGACACCAGCTTGGATACATGCGCAAATTATATGGCAGCACAGACCGTGCTTGCGGCTGCAAGGACATGAGCACGCTCTGCTCCGTGTGT
CCACGATCCAGCCGCCATTCGGCATGCCCTCGATCTGCATGCGGCGTGCGTTCACAGAGCGCACATTGTGAGCTACAAGCTTCTTTTCAGCTGCCGTGAG
CTGTAGAGGCTTGTGGTCGACCCTGTACATATCAGCTGCAACCGATCCGACTACAGGAAAACGATGCACCAAAAAGCATCCCCGGCTATACAGCAGCCGG
TACAGGCTCGAGAATCGCTCAGAGGCGGTGGCCACGAAGCAGAACGAAACGTCGCGGTTCAGAAACGAGAGCCGGGCCCCGTTGATTTCGAAGCAGCTCG
CTGGGGGTAGCCGGGCCGCCGGGGCACTGAATCTTCAGAACTTTGTGGTACTGCTCCAGCGGGTTGTTAGTCGCTGCGTACCCTCTCGGCGTACGAAAAG
CTTGCCAGCGGTTGAACCGAACGTTGGTTATCCACATCTTCGTGATATGGTTGGTTAACTTACGCGCCGGAGTGCCCTGCCCGTAAGTCTGCCATTTCGT
AAGAACTCGATCTTTCGAATCCGAAAAATCCACCTCACTAGCGTAGTGCAAATCGTACAAGTCAGCAAATATAACAGCTGAATCGGCATGAGGAACTTTC
ATCGCTTGTGAGTATTTCCACATATTTTGCATGACGTGAAACCAGCACATTAGCACCACTGAGCGCGGCAATTCCGACACACACGCGTTGAATTGGGCCT
TGTCGGCATCCATCATCACAAATTGCGGTGTGAATTCAACACCGCATGTATCCATGCACACCCGTCGCAGGTAGCGGATGCACCAGCCGATGTCGATGGC
TCTCTTTTGCGCTGTGCAATAGAACACCAGCGGAAAAAAAATGGCCAGAACGATCGGAATATCTAAACGCAAACACGACGTAGCCGTTGATGAGCATGTT
GTGTGTACTATCTACGTACAGATCGTCGTGCTGTCCGGTCGGCTCTGCACAGCAACATAATCTCGGACGAGGCGTAAACAGGTCATGCCAACTCGCAGAG
GATAGGCCGAGGATCCATCACCGAGATGGGAATCCAGGTAACCTGATTCATCTGGTGTCGTCTGCGAGTCGCACAGAATCACCATCTCGGTGTCGGCGTG
TGACGCAACGTTGACCTGATCGTAGAGTCGACCATCGCACAGAGCAATTAGCGGTGCCATAGAGTCCTTGGGATTCGTGCGTCTCCAATTCTTGACGAAA
TCCGCCACCTGCGTGGATTTAGGCGCAGGACCAGCCATGGACTGCTCGTCGACAAGCGCACACAAGACGGTGTGCAGCCTTGCAGCAGTCGCTTTATCTC
CACCACTAAGGCTGCTGATAATATAGTATTTCATCCCCTGTGTGAATTGTCGCTCGACTGGCGTCGGAGGGTCGTTTATGTCCATCACATGATCGCCTTG
CTGGAATACCTCACACGCACTAGACGAAAGGCACAGCTTGAACTTGTAGCAGCAAGGACAGGGCGGAGGTGGCCCGGAAAAGCCAACGTTGAGACGTTTT
TGCTGCTTCTTGCAGCGCTCGGAGCGACAAGGAACCATCTGGGACCGCATTGTGTGCGAGCAGCGATGTAGATCGTAGTCACGGTCGAGTAAATGGTTGA
AAGTACATCCAACTTGAGTACTTTTATCGACAGCATGTGTAGGCATCGAGGTCCTGAACTCTTCCGAGGTGTCGGTGGTTGTAGCTCGCCAAATCCTTGT
CCATGGTGGACGTTGACGC