Description :
From Genome Similarity Track
Location :
Scaffold_668:17531- 18920
Transcript NameFunction/comments
Phypl_g10205hypothetical protein

Sequence
1389 bases(100 bases per row)
CATACTCGGGTCTGCGCGACAACGCACGTTGAGCTTGCCCGGCTTGAACTCAATGCGGAAGGTGTATTCCGCGAAGAATGACAGCCAGCGCTCCAGCCGC
TGCGACAGATGCGGTGAGTTGGCGGCCGTCCGCAAGGACACATGGTATGTGTAGATCACAAAGGGTCTTGCGCCCAGGAGGTGCACCCTAAACTTGACGA
GGCGTACTTCAAAGCCAGGAGCTTCTTGTCATGGACAAGGTAGTTCCGTTCGACCTCGTAACTGGAACGAGATGACACGCTCGTGTCCATCCCGTCGTCC
TGTAACAGTGCTTAGGCCCTTGGTTCAATCCCCGGTGTGTCCAGCTCTTTGCTCGACTCACCTCCTCTTgcacgctgcgctgcgaCGCCCAACTAAGCAA
TCGATTGCATAGTCGGTAGCGTCACAGACGACGCTGAACTGCTTCGCCTCGTCCGGCAATGCCAGGATTGGCGCGCACTGTAAACACGCCTTGATGTTCT
CAAACGCATCTTGGTGATGGGGCTCCCATAGCAAATCGATTTCCTCCTTCAGACGGCCCGACAGAGGCATCACCAGGCCGTGTAGTCCGCACTGTAGTTG
TGCAGGTAATTCGCCAGGTCCAACCACCGGCGAAGGACCTTCCGACACCGATGAGTAGGGCAAGCCGCGATGGCCTTGACCTTCTCCGGATTGGCACGGA
AACCCGCGCGACCGACAAAGCAGGCTAAGAACTTGATCTCCCCTGCGGCAAAGACGCACTTGTCGATGTTGGTATAGAGCTGGTTAGCTCTCATAACCTC
AAACACTCGACGGAGGTGCCCTTGATGCACCTCCATAGCTGTCTGGCCGTCCACACCACGGCTATGAGCGAAGATGTCGTCAAAGTACGTTTGTGCGAAC
GCACGCAAAGGTCGGAACAACTGCATGACCAAGCGATTAAACGTCGCTGGGGCGTTCGAGAACCCTTGCGGTATGACGAGCTACTCCCAGAGTATGCAGC
CCGGAGTGCTTACCGCGGTGAGCGAGATGTCACTCTACCGTATCAGGATATGATTGAATCCGTCGACCAGATCCAACGCGCTGTAAAGCGTGCAGCCGGA
CATGTTGCTCAACAACACATCCTTTCGAGGGACGGGCGTCTGGGCCGGCAACGCAGCGCTGTTTAGCTTGTTGTAAGCATCAACCAGACGCCACTTCCCG
TTCGGTTTCCGAACGCAGAAGGTGAGTGTCGAGTGCGGGGACTTTGACTCCCGCACCATGCCAGCCTTCGCTTTCGCAGCGAAGAAGACATCTATGACCT
CGCACAACTCGCGAGGTAGAGGCTATTGTCTCGTGACACAGTACTTCGTGCCTGGCACGAGATCAATCTCATGCCTGACCCCCCTCCCC