Description :
From Genome Similarity Track
Location :
scaffold_38:175285- 177598
Sequence
2313 bases(100 bases per row)
TTGACACCGTTGCCTACGATGGAAGAGCTAAAGCAGCTCTAGGAGTCACTTACGATGACTTCGTACACGAACTCAagtgtgatgacattgcGCAGGTCGT
GTTGCTACGGTCGAAGGTCGACTCAGCGGAACTACCTTGATTATAGGTCAGGAATGATCGGTGCTAGGGGCGTGTGAAGTCCCACAGAGGATCTACTATT
TTGAAGGATCAAAATGATTCTCATTTTTCACATGTTATGGATACAAGGATGACGTCCTTAGTGCGAACTCGCTCTCTAGGCTTCCACCCGACGGTGGAGt
ttgacaagaaattgattgTATACCTGGTTCAACGCTTGCGGTGcttcgacagtggccactgtcgcgGGAATAAAGTAGGTAAACCGATGAGTTCTTTGTT
AAAAATAAGCTGCTGggttgatgaagaagatcaagGGTTCTCGTAGCGCACTGACGTTTTGCGTACGTATACCAAATGATAAACGGCGTATTGCTCACGC
ATTTAACAAGTTGAAGGCGCAGACGATCCCTgcgcaaacgccgattcTGCGTAAGGATGTCATCATCCACCAGGCGTCCGGCGGTTCAGTGTACTTATTT
TTGATAGATGGATATTATCAAATCTCGATGAGCGGAGAGGATGTCCCTTCGACGGATGTTACCGCACCATCCGGTATGTTAATGGTGTGGCTTTTGATAT
CACAGGGACTATCCATTGCCCCAGTAGCGCATAATCGATTGGTCTCACATTTGTTTCGACCACTGCGATGCTTCGCACAAACGTAACTCTGTCGAAATTT
GTGTCAATTCGAATGACGAAGAAGGAAAATCTGCCGACGAAATGCACTTGGTGCACCTCCGTGCAATGACATTCGTTGCAAGCGAATCTGGCAAAGTATA
TTTTTGGTGCTAATAGAGTACCGGTCCTCGGTTGTTATGTTGGTGAACACGGTGTTCGTGCATACCCTGAGAAggtcaaagcaatcgtgAAGTGGCCGAC
GCCAAATAAATCAAGCCAAGAGGAAAGAATGGATTGGTATCTCCAATTGCCCAGGTCGCTTCTTACGTAACTACGCGGGCATGTTACGCCCACTATCAAA
CTTACTGTAAAAGGACGTACGATGGATGTTGTCATCCATTCACTCGAATCAAGAACAGCTTGATGGAAGCACCATAGCTTGCTTTACCAGATGATTCGAA
GCCCTATAGCGTGGTGTATGACGcttctgagtttgcaatcggttgtacattattgcaaaaggacttagaaggacacgatcgtgtcgtgtcctttcaatcg
cgacagctgaagccaGAAGAAAAGGAATAGCatgttcacgacaaggagcttTGAGTAATGAAATATGCTCTGGTGAGGTTTTGTGTTTACCGCTTGGGTT
CAACTCCGTTTGTCGTCTACCCGGATCATGCAAGTTTGCGTTATGCAGTTCAATCACCTCACTTGTCACAGCAAATAGTTCGCTGGTTGTTGatcttcgc
agaatacaacttcaTCGTCGCGTACAAGCCAGGGAAGTTGATCGTGCTTGCAGACGGATCGTCGTGTCATCCTGATTATGAGCTCGCTCATATCACTTAT
ATCGAAAGCAATGTACTCAATATGATACGCCGAGCGTTTATTGAGAATAAACAATTTAATCTGATCATCAGAGCACTGTCATCGAGTGATTTGGAATTCC
ATGACAAGCTTCCTGGTCGCTTGAATTTAGGCGTCATCGTTATATATGGAAGTATATTATCAGTTGCATGTGGCAACgggccacgaattgtggttcccca
CAATGATGATTTGGAGTACAAGATAGTGCACGAGGCAAAAGATATGCAGATGGCCAGTCACTTAGGCGGAGAGAGGACTTATCATTTATAcagttttcaa
ttttgatggctCATATGTACAAGTGAGTGGCACGATACGCGATTTCTGCCAGCATGTGAAGAGCGCAAGCCACACGCTAGTGCCTCTGCATATTTTTCCT
TTTCTTACTGACCGTTGGAAGTCAGTCGGTCTTGCCTTATCTTGAGATTTGCCGAGAATGTGCACGACCACAATAGAGTCCTCGTGTTTGTTTACAAACT
CAGTAAGAGGATTTGCAATGCTCCGTGTAGCGATTCCACCGATGCCAAAGGTTCGACTAGATTGTTCGTTGACACGTGTTTTGCAATTTCTGTTGCCAGA
AGCCACCGTATCTAATGGTGTTGCACGATCTATGAGTGGCTTTTGGAAAACATTGTTTCACTTTTGCTTGGATGTGTCCACAGCGGTACACTCGACGACC
GATAGGCAAACAG