Description :
From Genome Similarity Track
Location :
Scaffold_39:175282- 176392
Sequence
1110 bases(100 bases per row)
ATCTTGGTGTACGTCACACCAAGAGTTACATACATTTGCGACCACCATGACGAGTGGTCCATAGAGACTTAGGAGTCCTATTGGTTGAAAGAAGCATCTT
TCAGCCAATGAGCGACATGCATAACAGAGGAATTCTGCCCACCAGCCGTTGGCAGACTTCTAGCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAA
AACAAAAATAGCAGTTCTCATCTTTTACCAAACCCTGCTACTTGGAGTCTTTATCTTGTTTAAAGTATAGTCGTGGATCTCGAGTATACTTAACTCAAGT
AAAAGAACCTGCGCTTCCTCATACACGTGCACATACGTGTAAGCCGTAGTAGTGACCCAAGGTAGGTCCACTGCACCTGGTAGCACTTTGTAGTCCGTCC
AACGACCGACTACCTAAGTTCGTACGTCACGGCACGAACGCGGAGCAGAGAACCTTCCCATGGATACAGATGTGCCCATGGAAAGCTCCACCACGCCTGC
AACTCATGTTGCACGCGCTGACTTCCCCCACCTGTCGGATCCATAGTGGGACTGTCAACATCCATTGGGGAGGCGGCTGTAGCTACGATGCCGCGTACGC
TAACGCCAACAGAGCAACATGGTGTTGCTCTGGGTTTTATCCTGAAGGTGCAGCGCGATGCTGCTTTCTCTACCACGGTGGCGTCGGAGACGACACCGCT
TGAGCAATCGTTGAAGCAAAACGTGAGCAACTATGTCGGAAGAGAGGGCGAGCCTCTCCTTCGTTGGCTTGTCGAACTCGACACTGCCATCGCGGCTCGA
CGTATCGGCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGGCGAGCGAGAAGTTGGGCATATGGACGCCGAGTCTCTGATCCTACGT
GCTTCAGCATTTCAAGGAGGAGCTCAAACAAGCGTTTGAGCCGCCGCAAAATGAGTTTTGGTCGAGGGCAGAGTTCCTCGACCTACAGCAGGGTAAGCAT
GATGTTCATGCATATGCGCAGAGAGCACGGTACTTGGTCTCGAACATTGTGACCACCCCGGTCGACGAGGCGACCAAGATCGTCCCGTTCATGAAAGGAT
GTAGGGATGG