Description :
From Genome Similarity Track
Location :
Scaffold_256:17528- 20448
Transcript NameFunction/comments
Phymu_g7609hypothetical protein PHYSODRAFT_345030
Phymu_g7610hypothetical protein

Sequence
2920 bases(100 bases per row)
TGTAGAGCCCCTACAGTAGTAGGCTACGAGTCATGTGGTAaagttgtacatgtagtgaatCAACACTCGAGAGATTGTTCACCTTCAAGGTGTAAACGAA
CAAAAAATCCAATCTGTGGATTACCACACTGAATAATCGATGAGATTGCTTATTCTCGTCTATCTGCAGTTCTGCGAAACGCCAACACCTGGAAACAATT
CACTGGGGGAAAGAAGACAGACACCAACGCATTTGCCACAATTGAATCAACATTCGAGCAACCAGcgcacttccagcagatcaaATGACCAAGAAAATCA
CGCTCTTGTTTGCGCACGGTGCAGGCTTTTGCAAGGAAGTGTGGGAGCCCGTTACACGACGACTGCGAGAGTCTCTGTTACTACAGAATTCTGCAGTCGA
GACGGAATTCGTAACTTTCGACTTTAAGTATCACGGCAGCAACCGAGACGAGTCCGAGGCGCCTCAAGTGGACCTTTCCGACACGATGTCTCCTCGTGTA
TACCATCCTGCGGGCGACTTAACTACCTGGACGACTGCATACATGTTGGAgttggtgcaggagctcaagacgaaGCAACCTGACCGGGTTTTAATCGGAG
TGGGTCATTCCATGGGAGCGTGTGCACTTTGGAACGCGGAGGTGCAGCACCCTGGTACTTTCGACGGACTCGTTCTGTTCGAACCGGTTTACGGAGATAT
GAACGTCGACCCGGTCACGGACTTCCTGGTGTCGATCACTCTGCAGCGCGAGTCTTCCTGGCCCTCGCGCGAAGCAGCGGAGGCCTATCATCGCGGTTTG
AAGAACTTTAAAGCTTGGGATCGTGAGTCACTGGCGGCCTATTTGAAGGGTGGCCTTGTGGAAGACAAAGCGACGGGGAGAACGGTACTGGCCTGCAGTC
CAGCTATGGAGTCCTCGTTCTACTGCCACAAACTCATGTTCTGCTCCGACGAGCAGCTGGCACGCGTCAAGTGCAAAGTATTTGTGCACAGTGGGGGTCG
CTCGAAGATGTTCCTGTTGTCAATTTTCGACGACATGAACGAAAAGTGGCCCCACATTTACTCGGTGGGGAAGCCCATTCCACGCAGCTCGCACGTCATG
ATCTTGGAgaaaccagcagcagtcactCGCAAGATCCTGGAGAGTTTGGAACAGCTAACAGGCGCTGTCATTCCTCTCTCCAGGCTGTAAAAAACTCCTG
TACATATATGCATTTCTTGAAATTAGACGTCGCATTAGTTTTGTTTCTTTGTTTCTTTGGACTTCGCTCACCTTCATTCTTGATTAACGCGTGTAACAAT
CACGATTCCTGATTACCTCGAGCCGTTAGTGTCGAGTCGACACGTTTCAAATCTCCCTCGCTTGCTCAACCACTTCAAGCTCATTCTGTTCACAATCGAA
TTGGAGATCTACAGCTCACGCGATGTCCAAGGCGGCTGCGCTGTTATTTGCCCATGGCGGTGGTTTCTGCAAGGAGACGTGGGAGCCCATCATGCGTCGT
CTGAAAGCTTCGTCTCTACTGCAGACGGTGAACACGCAGTTCGTGAGCTTCGACTTCAAGTATCACGGAAGCAATCGGGACGTTAGtgtggacgccaaga
tcgaTCTTGAGAACCCTGAGGGGCCGAGGGTGCACCATCCAGCTGCAGACCTCACTGCGTGGACGTCCGCTGAGGTGTtacaacaagctcaagcactcaa
gagcaagagcgacaacACTCCTTTGATCGGAATCGGCCACTCTATGGGGGCTTCGGCTATGTGGAACACCGAGACGCAACACCCAGGCACCTTCGACGGC
CTCATCTTGTTTGAACCTGTATACGGCAGCCTCAATTCCTCCGTTGTCACTAATTTCCTCGTTTCCATCACGTTGCAGCGCGAATCGGAATGGTAAGTAG
CTGCAGGATTCGAGATGGATCACAGTTCTTGATGCTAACCGAAAGCGTTTTAGGCCCTCCCGAACGGCGGCGGAGGAACATCTGCGTGGTTTCAAGAACT
TTGCAGCATGGGACCGAGAGGCGTTAGACGCCTACATGAAAGGAGCCCttgtggaggacgagaagactGGGAACACGGTGTTGGCGTGCAGCACTCCAAT
CGAGGCATCTCTCTACTgccacaagctgcttcacTTGGCGGACGAGCAGCTAGCGAAACCACAGTGCAAGATTTTCTTCCACTACGGCAGTCGCACCAAA
ATGTTCCAGCCCCCAGTGTTTAAGGAGCTCGCTGACAAGTGGTCGAACATttacgagctggaggagcccATTGGCAACTCGTCCCACGTGATGGTCCTCG
AGAAACCGGCGGAATCCGCCCAGGCAATTCTCAACAACCTGTACGAACTGGAGCCGTTTAACGAGGAGAGTCAGCCCAACGTAGCGAGCTGTAGACTTTG
ATAATCTAAGTAGTTTTATACAGTTATAAACACATTTGGTTCAAAACAGCAGTATCAACTTGTAGTATGAATACAGAGTAGTAATGCTATTGTTGTAGTA
CAGTATATGTCGTAGCACATCAATCACATGATGGGATTCACATCAATCCACGTGTACTGTAGACTACAGTCTGTAGTATCAAATCTACTTCGTGACCATg
tcggacgaagaagaagagaaagaatTACTCGACCAGGATCCGGACCTTAAAGAAGACTTCGGCCGCGCGGAGTGGCCGTTCAGTGACAAGGGGGGCCTAG
ACGATATCCCAGTTCCAGCAGGAGAGGCGTGTGCTAAGATCAGTAGTGTGCTATCTCATGCAAGCGAACACTCGGGGGATTTCTCCTTCGGTGGGCAAGC
AGAGCAGCTACCAGCCATACCAGGTCTCTTTGTCGACGAGGTAGGGCCCATTCCTGTGCCTTTGTGGGACGAGAGGGCTCGGGAACTGATTGACAAGGCT
GAGAAATCTCCTTTTGGACA