Description :
From Genome Similarity Track
Location :
Scaffold_63:17527- 22625
Transcript NameFunction/comments
Hyaar_Emoy2807358cell division protease ftsH
Hyaar_Emoy280735940S ribosomal protein S2
Hyaar_Emoy2807360hypothetical protein

Sequence
5098 bases(100 bases per row)
GCTCGGAAGCGCGGCCACCAAGCGCCATGCACATCATGTCGGTCAGAGCCTCGCTGCTGTGCAGCGCCACCTCCTTTGGTAGATACTGCGCGTACCCAAG
AGAGCCTTTTCCACGCGGTACGATGGTCACCTTCAGCAGCGGATCCGCATGCTCCAGAAACCAGCCAGCAACAGCGTGACCAGCTTCGTGGTACGCCACC
GTCTTCTTCTCGTCCGGCGACATGATGCGATTTGTTTCTAGTCCACCGATCACACGGTCCGTGGCTTGTTCGAAGTCCTTGAATGATATGCTTGTACCGT
TTCGTCGGGCAGCTACAATAGCCGCTTCATTGCATATATTAGCAATCTCAGCACCAGCAAAACCTGGAGTCAATGCAGCCATTCGACGAGCAAAGTCATC
GACGGCGCCATTCAGCGTCAGCCCCTTAAGGTGTACCTTGAAGATCTCACGACGGCCCTTGATATCAGGCACATCGACAGTAATCTGTCGGTCAAAGCGA
CCAGGGCGTAAAATGGCTTTGTCGAGAATGTCTGCGCGATTCGTACCGGCAAGCACGACCACGCCCTCGCTCGAGTTAAACCCATCCATCTCGACCAGCA
GCTGGTTAAGCGTGTTCTCGCGCTCGTCGTTGCCACCTGTGAAGTTGCCCTTGCTGCGTGAACGCGCCACTGCGTCAATCTCATCAATGAAAACAATGCA
CGGAGCGTTCGCACGAGCTTCCTTGAACAGGTCGCGCACACGGGATGGGCCCACACCAACGAACATCTCGATAAAATCTGATCCAGAAATGCTAAAGAAC
GGGACGCTAGCTTCACCGGCAGTGGCTTTCGCCAGCAGCGTCTTTCCTGTACCAGGCGGGCCTACCAGCAGGGCACCCTTCGGGATCTTGGCACCGAGGT
CCGTGAAACGCTTTTGGTTGCGAAGAAAATCAACGAACTCCATGATTTCTTTCTTGGCCTCATCCACACCAGCCACGTCCTTGAACGAGATCTTAATGTC
CTCCTTGGTGATCTTCTTGGCAGGACTTTTGCCGACCTTGAAAATGTTGCCGATCCCACCACCGCCGCCACCAGCACCACCTCCCACACCACGCATGGTC
ATGAGCAAGAAGCCAATCAGTACAATCGTCGGCAGGAACTTCATTATCTCCGCTGTAAAGCTGATCTCGTTCGTATACTGCACTGGAATGTAGTCATGCG
GACGAATGCCCATCTGGTGCTGTGCGTGCTCAATCTGTCGCTCGAAGCCATCTACGCTGCCAATGTTGAAGTAGTACACAGGATTGGAGGTTTCACGACC
AGATGCGCCACCACGTGATCCCATACCAGGCACGTTCAGTCCGCGACCGCTGACGTCATTTGTCGGATACTCCGACTCGGATGCAAAATCGTACTCGTGC
TGTCCTTTGGCATGAGGATCCCGCCAGTCCGACATGTCACTGGCATTGCCAGGCACTGCACTACCCTTTCCAGACGACGAAGCACCCGGCGTATCGTTCA
AGAAAACTTTGACGTACTTCTTGTTCACCACCACCAGTTTCTCCACACGCCCCGACTCTAAAAAAGAGTTTCGGAACTCCTGATAAGTGATTTCCTGCAT
AGGCTTGTCCGTCGACGCCAAGTCGGCCAAAAACATTGCAGCTACAGCGGCCGGTATCAAGTAAGCCATACCATCCTTGCCGCTGGGCCCTCCACGATTA
CCTGACGAGCCTTTTCTCGCCCCACTGCTTCCCTCTGAAGTCTTTGAGCTCAGCTTCTTGATGTCCGTAGATCCTTTCTCCCCAGCCTTTGGGGCGCTTT
TTGGTGGGCCATTAATCTTGCCACCATTTCCTCCGTTCTTTGGATAAAAGCGGCCAAAGCCCTTGGGAATGTTCTCCTGCAGCCACGTCGTCCAGCTCAA
TGGCTTATCTGCTTTTGTCCCTCGTACTGCATCACACAAACAAACAAAGATACACATTGTACCCATATCATATCCGTGTACTACATTAGTACCACTGCAG
CACCTAATTTCAAACCCACACAAAAGACCAAAATACTAAAAGACCAAAAGTTTACAATACAAAAACCCACGTACACAAAGTATGGGGACGACTAAATTGC
AGCCAATGGCGCGTCTGCACCGCTGAATTCTGCGGCAGTTGACGAGCAATAGCGCGCCCGCCATTTCGCTGCAATGAACCTGACAGTTGCTGTCACACAC
ATAACACAAGCACACAATATACTCATCAAGTTAGAGAGGGTCACGTCTACACGATAACTCATTATTAGCATCACTATAGAGACAGCATCTACAGTATACA
GACGTGGTGAAGCAAGTGCAGGCAGCGATCGTGGCGGAGGCGCTGGGATGCCGTCGTCGCCCTTATCATGGTTTAGTTTGGTCGACGAATACTGACGTCG
CTTTCAGGGAAGGTTACACTGTATCCAGCACCTCACATTTATCCAGTAAATACAGCGTCACATGTAATGTATTTGTTTCGAAAGGATATATAATGCTTAC
GATTCGTGATATGTGAGATTACAATAGACAACTGTACCTATCTATATATAATTTGAAAGCATAATTAATGATTAGATTATCAACGTTGTTGCGGTTGCTC
GAAGCGTATTTACCATCATGTTTCCGCGACATTGTCCGTCCGCGCAACATCTCGTGGATACAGTGTACCTTCGCCCCACCTTCATAATCGACTGGACAGG
AGGCGAGCACGGCGACGACGTATCCTTCCACCCACTTGTATTCGTTCATTTCGCCCCGAAGAAACAGGACTTTTGCTTGCCAATGGCTGACGCTGCACCG
ACTGGAGAACGTGGAGGATTTGGCCGTGGCCGTGGTGGTCGCGGTGGTCGTGGCGGCCGTGGACGTGGCCGTGGTCGCGGCCGCGAAGAGTCGAAGGAGT
GGGTCCCTGTGACGAAACTCGGCCGTCTGGTAAAAGAAGGCAAGATCGGCTCGCTGGAAGAAATCTACCTCTTCTCGCTGCCCATTAAGGAGTGCGAGAT
CGTCAACTACTTCCTCGAGTCGTCGCTCAAGGACGAAGTCATGAAGATCATGCCCGTGCAGAAACAGACGACGGCTGGTCAGCGTACGCGTTTCAAGGCT
TTTGTCGCTGTGGGTGACAGCAACGGCCACATTGGCTTGGGTGTCAAGTGTGCGAAGGAAGTGGCTACGGCGATCCGTGGTGCCATTATTCTGGCCAAGA
TCTCCCTCGTCCCGGTGCGTCGCGGCTACTGGGGCCGTATGGTTGGAGCTCCCCACACTGTTCCCAACAAGGTGACAGGCAAGTGTGGCTCTGTCCGTGT
GCGTCTCATCCCGGCTCCTCGTGGTACGGGTTTGTGTGCTGCTCCTGTGCCCAAGAAACTCCTGGGTATGGCCGGCATTGAAGACTGCTACACGTCGGCT
CGTGGCCACACGCGCACAATGGGGAACTTTGTGAAGGCGACTTTCTATGCGCTGCGTGCGACGTACGCATACTTGACGCCGGACCTTTGGGAGCAGCACT
CGTTTGTGCCGTCGCCTTACCAGGCGCACACGGACTTTCTGGCCAAGACTGCTATCAAGAAGTAGATGGACATGCGTTTGGCTCGACAGTCATCTCAGTC
TCAGTCTGGTGAACAAGCAGTGGACGATCTGAAAAGCTGCAAATGGGTTTGAAGAGGGGACGAGGCGTGGAAGTCAAGTGCTACGGTGATGAGTCTCCCT
CCTTTGTGGTGTAAGTAGCTTAGGGAGAGCGTCGGGGCGACGCTACGGTGCGTAGGTGTCGACCCTGAGTTACTTTAATACAAAGAAAGCATTTGCAACT
TTTACTTGGTCTCCAGATCTCATATGTGTAGATGCGATGGGGTCCAAAATGAAGGCGCCCGAGTCTGTCATCATCACGTATGACGAGCAATTTTTACAGC
TGACTTGACACGCACTAAGTCAACGTTCGTGGTCATATCTCCTCACGATTACCAGCACCACGCTGCATCTTTATTTCTATTAGCAGATAGTTGCCATTAG
AAGCGACAGCAAAGGAACACTAGTTCGACATCTTCCCGGTCCACCTCATAGGATGCTATTGATGAACATCCTACTTGACGCGCTACATGACGCAAAAAGC
TGATGAGGCGGTCAATCATAAAACGGCAATGTCGCATGACATACTTGCTCTTGTACCTCCGTCTTATTTGTCCTTCTTGGGCACGTTGTCCTCCGTCGGA
TCTTGAGCGTGGTGGGTTTTCATAACGCCAACGCTTTGCTCCAACAAAAACGACACGATCGGCGTGATCGTCGCCAGCTTCTTCTGGAGCACAGCGGCAA
TGTCCACGATCCGCTCCTTCAGTGCATGCACCTTTTCGTCATTCACGGGTGCAGCTTCTTCAGCGCTTTGGAGCTGGTCACGTACGGCCTTCAGTTCAGC
GCCAGCAACGAGGACGACCTCAAATGCAAACAACTCGTTCATGAAACGCCTACAATAAGGATAGCACTGCTTTAGTTACCAACCACGTCACATATATACT
GAAATAAGGACGTACGTTCTATCGTTGCACGAGCAAAAATAGTCATCACACAAACACGTATATAATGTCAGTACAAAAATAGCTTTTTTTCCATGGCATG
AAAAACTGCTTTTTTCGTCGTTATCTTCCTACCCGAGAGCTGGCTGCTGCACCGCTGATGTTCCTGCTGCAATCGACCATTTCCGATATAAAAAACAAAG
TACAGGAAACACCAGTAGCAGGCCGTGCCACAGCCCTTTCCAGTACGCTGACGAGTCTTCCAGACACACTTGCATGCCAATCAAATCGAAATTGACGTTT
TTACAGAGTGCTCAAATTCAAACCATCTGATGTATTGTAAGGCTAAAAAGAAGCTCAATTCTTTCGCGCTCCTTTTCCACTGGTTTGTGAGTCTATTCAA
ATACACATATTCTTATTTAGAAACTATCGTTTACAACGGTATAAAGTGAACCTCACATAAGGCTATTGTGATGGCCACGCTGTAGCTGCTCAGCTATTAT
CACTGCAACACCTTAAAATAACCCTTCTACTTCGTAATGAAACCACATTGCTTTTCAAATGCAGTATATGAAGACAAAGTGAGAGCACTATCCTTTTC